Quantifying Yersinia pseudotuberculosis Type III Secretion System Activity Following Iron Starvation and Anaerobic Growth

Summary

Bacteria colonize host tissues that vary in oxygen and iron bioavailability, yet most approaches to studying bacteria use aerated, rich media. This protocol describes culturing the human pathogen Yersinia pseudotuberculosis under varying iron concentrations and oxygen tension, and quantifying activity of the Yersinia type III secretion system, which is an important virulence factor.

Abstract

A key virulence mechanism for many Gram-negative pathogens is the type III secretion system (T3SS), a needle-like appendage that translocates cytotoxic or immunomodulatory effector proteins into host cells. The T3SS is a target for antimicrobial discovery campaigns since it is accessible extracellularly and largely absent from non-pathogenic bacteria. Recent studies demonstrated that the T3SS of Yersinia and Salmonella are regulated by factors responsive to iron and oxygen, which are important niche-specific signals encountered during mammalian infection. Described here is a method for iron starvation of Yersinia pseudotuberculosis, with subsequent optional supplementation of inorganic iron. To assess the impact of oxygen availability, this iron starvation process is demonstrated under both aerobic and anaerobic conditions. Finally, incubating the cultures at the mammalian host temperature of 37 °C induces T3SS expression and allows quantification of Yersinia T3SS activity by visualizing effector proteins released into the supernatant. The steps detailed here offer an advantage over the use of iron chelators in the absence of iron starvation, which is insufficient for inducing robust iron starvation, presumably due to efficient Yersinia iron uptake and scavenging systems. Likewise, acid-washing laboratory glassware is detailed to ensure the removal of residual iron, which is essential for inducing robust iron starvation. Additionally, using a chelating agent is described to remove residual iron from media, and culturing the bacteria for several generations in the absence of iron to deplete bacterial iron stores. By incorporating standard protocols of trichloroacetic acid-induced protein precipitation, SDS-PAGE, and silver staining, this procedure demonstrates accessible ways to measure T3SS activity. While this procedure is optimized for Y. pseudotuberculosis, it offers a framework for studies in pathogens with similar robust iron uptake systems. In the age of antibiotic resistance, these methods can be expanded to assess the efficacy of antimicrobial compounds targeting the T3SS under host-relevant conditions.

Introduction

Many clinically relevant Gram-negative pathogens like Yersinia, Vibrio, Escherichia, Pseudomonas, and Shigella encode the type III secretion system (T3SS) to inject effector proteins into host cells¹. In many bacterial species, the T3SS is under strict regulatory control². For example, translocation of Yersinia T3SS effector proteins into target host cells is critical to subvert host defense mechanisms and enable bacterial colonization of host tissues. However, Yersinia T3SS activity is metabolically burdensome and can trigger recognition by host immune receptors³. Accordingly, regulators that sense specific environmental cues control the expression of T3SS genes in many bacterial species. As pathogens such as Yersinia experience environmental changes during their infection cycle that impact the expression of critical virulence factors, it is important to develop laboratory conditions that mimic salient features of host niches occupied by bacterial pathogens. Specifically, oxygen tension and iron availability differ among various tissue sites in a spatiotemporal manner and impact the expression of virulence genes such as the T3SS^4,5,6. Therefore, the goal of this method is to assess how oxygen and iron impact the expression of the Yersinia T3SS. This will provide insight into the dynamics of the host-pathogen interaction.

The method described here details how to culture Yersinia pseudotuberculosis aerobically and anaerobically, as well as how to deplete Yersinia iron stores during aerobic or anaerobic growth. There are a few important considerations highlighted here regarding successfully culturing bacteria under these variable conditions. First, anaerobic culturing requires additional glucose supplementation, a modification that is noted in the media recipe. Second, since Y. pseudotuberculosis employs siderophores and other iron uptake systems that can robustly scavenge iron from the environment, special attention is devoted to ensuring the culture media and laboratory glassware are as free of iron as possible⁷. Previous studies have used iron chelators such as dipyridyl to deplete iron from rich-media bacterial cultures to mimic iron starvation^8,9. However, depleting Yersinia iron stores to induce iron starvation requires the removal of residual iron in glassware and media as well as prolonged growth in the absence of iron. This protocol details how to acid wash glassware and chelate media to remove residual iron, in addition to culturing the bacteria for several generations to ensure thorough iron starvation. Iron starvation can be ensured by measuring relative transcript levels of well-characterized iron-responsive genes across conditions, as demonstrated here with yfeA, and bfd.

The culmination of this protocol demonstrates how to precipitate secreted T3SS effector proteins from each of these conditions by treating the culture supernatant with trichloroacetic acid (TCA) and visualizing secreted proteins through SDS-PAGE. Finally, relative T3SS activity is assessed by visualizing secreted proteins via silver staining and quantifying relative levels of T3SS effector proteins, referred to as Yersinia outer proteins (Yops)¹⁰.

T3SS activity assays generally utilize specific antibodies to detect T3SS effector protein levels in the culture supernatant. However, western blotting antibodies for T3SS effector proteins are often not commercially available. Therefore, special attention has been taken to ensure that the final visualization of T3SS activity in this method does not require specific antibodies, and instead can leverage silver staining, which allows for the visualization of all secreted proteins. While this method is specifically tailored and optimized for Y. pseudotuberculosis, it can be adapted to other bacterial species, though the exact media conditions and incubation times will vary.

Protocol

The details of the reagents, media composition, primer sequences, and equipment are listed in the Table of Materials. Figure 1 illustrates the overall experimental workflow. 1. Preparation of acid washed glassware and chelated M9 media NOTE: Before starting, refer to the material section for the exact reagents and recipes that will be used. M9 media was first used for Yersinia T3SS assays in Chen…

Representative Results

This method allows for the relative comparison of secreted Yops across various conditions relative to a reference condition of interest. The overall experimental workflow is depicted in Figure 1. Table 1 depicts a representation of how cell culture normalization would typically occur in the instance of each culture condition and the volume of TCA that would be added to each supernatant. Here, representative results are shown using wildtype (WT) Y. pseudotuberculosis…

Discussion

The T3SS is an important virulence factor in many pathogenic bacteria; therefore, developing laboratory techniques to study its regulation is important for understanding pathogenesis and developing potential therapeutics¹. Iron and oxygen are known to be important host cues sensed by bacterial pathogens to regulate T3SS expression⁵; therefore, this method presents a strategy for culturing Y. pseudotuberculosis under either anaerobic or aerobic conditions, with iron…

Materials

10 mL Luer-Lok Tip syringe	BD	301029
10x SDS Running Buffer	Home made		0.25 M Tris base, 1.92 M Glycine, 1% SDS in 1 L volume
12.5% SDS-Page Gel	Home made
15 mL culture tubes	Falcon	352059	For initial overnight
15 mL Falcon tubes	Falcom	352196	For supernatant collection
250 mL culture flask	Belco	251000250
500 mL Filter System	Corning	431097
6 N Hydrochloric acid solution	Fisher Scientific	7732185
Acetone	Fisher Chemical	A949-4	4 L
Bio Rad ChemiDoc MP Imaging System	Bio Rad	Model Number: Universal Hood III
Borosilicate glass culture tubes	Fisherbrand	14-961-34	For anaerobic culturing
Chelex 100 Resin	Bio Rad	142-1253
Chelex M9 +0.9% Glucose media	Home made		6 g/L Na2HPO4, 3 g/L KH2PO4, 0.5 g/L NaCl, 1 g/L NH4Cl, 1% casamino acids, 0.9% dextrose, 0.0005% thiamine, 5 g/L Chelex 100 Resin. Stir media for 18 h at room temp, filter using 500 mL Corning filtration unit, then add MgSO4 for 1 mM MgSO4 final solution
Final Sample Buffer (FSB)	Home made		0.1 M Tris-HCl, 4% SDS, 20% glycerol, 0.2% of Bromophenol Blue
FSB:DTT solution	Home made		FSB+0.2M DTT
Image Lab Software	Bio Rad	https://www.bio-rad.com/en-us/product/image-lab-software?ID=KRE6P5E8Z	Software
Isotemp Heat Block	Fisher Scientific	88860021
LB Agar Plates	Home made		10 g Tryptone, 5 g Yeast extract, 10 g NaCl, 15 g Agar in 1 L total volume. Autoclaved
M9+0.2% Glucose Media	Home made		6 g/L Na2HPO4, 3 g/L KH2PO4, 0.5 g/L NaCl, 1 g/L NH4Cl, 1 mM MgSO4, 1 mg/L FeSO47H2O, 1% casamino acids, 0.2% dextrose, 0.0005% thiamine
Millex-GP PES 0.22um filter attachment for syringe	Millipore	SLGPR33RS	For FeSO47H2O filtration
Millex-GV PVDF 0.22um filter attachment for syringe	Millipore	SLGVR33RS	For supernatant filtration
Precision Plus Protein Unstained Standard	Bio Rad	1610363
SDS-PAGE Gel Apparatus	Bio Rad	Model Number: Mini PROTEAN Tetra Cell
SilverXpress Silver Staining Kit	Invitrogen	LC6100
The BellyDancer Shaker	IBI Scientific	BDRAA1155
Trichloroacetic acid solution 6.1N	Sigma Aldrich	T0699
Vinyl Anaerobic Chamber	Coy Lab Products		https://coylab.com/products/anaerobic-chambers/vinyl-anaerobic-chambers/#details
qPCR Primer sequences
yfeA forward – CAC AGT CAG CAG ACC TTA TCT T
yfeA reverse – GGC AGA CGG GAC ATC TTT AAT A
bfd forward – ccagcatcagccccatacag
bfd reverse – tggcttgtcggatgcacttc
yopE forward – CCATAAACCGGTGGTGAC
yopE reverse – CTTGGCATTGAGTGATACTG