We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system.
1. DNA Replication Template
DNA for the reaction is a linearized λ DNA modified by annealing of oligonucleotides to form a replication fork. Additionally, biotin is attached to the end of one strand of the λ DNA, and a digoxigenin moiety is attached to the other end of the same strand1.
Materials: Bacteriophage λ DNA, Oligonucleotides: biotinylated fork arm (A: 5′-biotin-AAAAAAAAAAAAAAAAGAGTACTGTACGATCTAGCATCAATCACAGGGTCAGGTTCGTTATTGTCCAACTTGCTGTCC-3′), λ-complementary fork arm (B: 5′-GGGCGGCGACCTGGACAGCAAGTTG GACAATCTCGTTCTATCACTAATTCACTAATGCAGGGAGGATTTCAGATATGGCA-3′), fork primer (C: 5′-TGCCATATCTGAAATCCTCCCTGC-3′), λ-complementary digoxigenin end (D: 5′-AGGTCG CCGCCCAAAAAAAAAAAA-digoxigenin-3′), T4 DNA Ligase, T4 polynucleotide Kinase, Heat block.
2. Beads
Beads are functionalized with a Fab fragment with specificity for digoxigenin. They can be then attached to the DNA replication template2.
Materials: Tosyl activated beads, α-digoxigenin Fab fragment, Buffer A: 0.1 M H3BO3 pH 9.5, Buffer B: 0.1 M PBS pH 7.4, 0.1% w/v BSA, Buffer C: 0.2 M Tris-HCl pH 8.5 (25 °C), 0.1% w/v BSA, Magnetic Separator, Rotator.
3. Functionalized Coverslips
To allow attachment of the DNA to the glass coverslip, the glass is first functionalized with an aminosilane, which is then coupled to biotinylated PEG molecules. This coating helps to reduce the nonspecific interactions of DNA and replication proteins with the surface3,4.
Materials: Glass coverslips, Staining jars, 3-aminopropyltriethoxysilane, Methoxy-PEG5k-NHS ester, Biotin-PEG5k-NHSester, Acetone, 1M KOH, Ethanol, Oven, Bath sonicator
4. Flow Chamber Preparation
The experiment is performed using a simple flow chamber constructed with a functionalized coverslip, double-sided tape, a quartz slide and tubing. One flow chamber is prepared for each single-molecule experiment2,4.
Materials: Double-sided tape, razor blade, quartz slide with holes for tubing, quick-dry epoxy, Functionalized coverslip, streptavidin solution (25 μL of 1 mg/mL in PBS), tubing, blocking buffer (5X: 20 mM Tris pH 7.5, 2 mM EDTA, 50 mM NaCl, 0.2 mg/mL BSA, 0.005% Tween-20), working buffer (1X: 20 mM Tris-HCl pH 7.5, 2 mM EDTA, 50 mM NaCl).
5. Single-molecule Replication Experiment
Once the DNA template and functionalized beads have been prepared, and the flow chamber is ready, a single-molecule experiment can be performed.
Materials: Prepared flow chamber, Blocking buffer (5X : 20 mM Tris-HCl pH 7.5, 2 mM EDTA, 50 mM NaCl, 1 mg/mL BSA, 0.025% Tween-20), Working buffer (1X: 20 mM Tris-HCl pH 7.5, 2 mM EDTA, 50 mM NaCl), T7 replication buffers with or without 10mM MgCl2 (1X: 40 mM Tris-HCl pH 7.5, 50 mM K-glutamate, 2 mM EDTA, 100 μg/ml BSA, 10 mM DTT, 600 μM dNTPs), replication proteins, inverted optical microscope with 10X objective, CCD camera, permanent rare-earth magnet, syringe pump, airspring, fiber illuminator, computer with image acquisition software.
6. Representative Results
In a successful experiment you should be able to observe more than 100 beads simultaneously (Leading strand synthesis). The experiment should yield numerous traces displaying leading strand DNA synthesis.
Data Analysis:
In order to measure rates and processivities of DNA unwinding and polymerization, the precise positions of beads must be determined. You can achieve it by fitting these positions with 2-dimensional Gaussian functions. Trajectories can then be extracted by tracking bead position at each frame using tracking software (e.g. DiaTrack). Now you are ready to visualize trajectories by plotting bead position as a function of time using any graphic software (e.g. Origin). To obtain rate data, fit the plots with a linear regression and calculate the slope. For processivity, determine the total length of the DNA from start to end of a shortening event (Figure 3). Both of these numbers will need to be converted to basepairs. To convert bead movement to basepairs, first you need to measure the length of a stretched λ DNA molecule at the reaction flow rate. Since the length of the λ DNA is known (48,502 bp) you can calibrate the number of base pairs/pixel at experimental force. For increased accuracy, subtract from the traces of interest a baseline trace of a bead tether that is not enzymatically altered. Combine all single measurements and plot rate and processivity distributions. Fit the data using Gaussian and single-exponential functions, respectively (Figure 3).
Figure 1. Single-molecule experimental setup. (a) Duplex λ DNA (48.5 kb) is attached to the surface of the flow cell via the 5′ end of one strand using a biotin-streptavidin interaction, and the 3′ end of the same strand is attached to a bead using a digoxigenin anti-digoxigenin interaction. A primed replication fork is formed at the end opposite the bead to allow loading of the polymerase. (b) Bead-DNA assemblies are stretched using laminar flow of buffer and imaged using wide-field optical microscopy. By tracking the positions of the beads over time, while maintaining a constant stretching force, the lengths of the DNA constructs can be monitored. (c) Extension profile of ssDNA (filled circle) and dsDNA (open circle) under low forces. Dashed line shows crystallographic length of fully ds-λ DNA, 16.3 μm. The large difference in length between ssDNA and dsDNA at forces around 3 pN allows a direct observation of conversions between ss- and dsDNA by monitoring changes in the DNA length. The simultaneous visualization of large numbers of DNA-coupled beads allows for the study of many individual replisomes in one experiment.
Figure 2. Bacteriophage T7 replication proteins: DNA polymerase (complex of gp5 and thioredoxin) and DNA helicase (gp4) synthesize DNA leading strand in the presence of deoxyribonucleotides and magnesium. This process is accompanied by shortening of DNA lagging strand due to coiling. Conversion of dsDNA into ssDNA changes position of the bead. Measuring position of the bead allows precise determination of the rate and processivity of DNA replication.
Figure 3. Example of typical data from a single-molecule leading-strand synthesis experiment. Processivity of DNA replication is equal to a total length of the DNA from start to end of a shortening event. The rate of DNA replication is obtained by fitting the plot with a linear regression and calculating the slope. The inset shows rate and processivity distributions that were obtained by combining data from a number of measurements. Data were fitted using Gaussian and single-exponential functions, respectively.
It is important to ensure that the drag force exerted on beads by laminar flow doesn’t influence enzymatic activities of the replication proteins. For instance, a 3 pN force that corresponds to a flow rate of 0.012 ml/min does not affect replication of the DNA leading strand. It does however affect enzymatic activities that take place during coordinated DNA synthesis, and it therefore has to be reduced to 1.5 pN. The drag force can be easily controlled by changing the flow rate or a width of the flow channel5.
The DNA stretching assay employs length differences between double- and single-stranded DNA. In the experiment described here the conversion of dsDNA to ssDNA occurs as a result of the leading strand synthesis (Figure 2). You should remember that the ssDNA is shorter than dsDNA only at low stretching forces below 6 pN (Figure 1).
A possible improvement of this method is to modify the lagging strand of the replication template by attaching a second bead to its 3′-end. Such alternation would allow direct observation of enzymatic activities that take place at both strands of DNA.
Apart from studies of the leading strand synthesis and coordinated replication, the DNA stretching assay has been successfully employed to examine the single-molecule kinetics of λ exonuclease, and dynamics of polymerase exchange during replication5,6. In principle, this method can be used to study any DNA processing enzyme.
The development of the DNA stretching assay was aided by Paul Blainey, Jong-Bong Lee, and Samir Hamdan. This work is supported by the National Institutes of Health grants to Charles Richardson (GM54397), and Antoine van Oijen (GM077248).
Material Name | Typ | Company | Catalogue Number | Comment |
---|---|---|---|---|
Bacteriophage λ DNA | New England Biolabs | N3011L | ||
DNA Oligonucleotides | Integrated DNA Technologies | |||
T4 DNA Ligase | New England Biolabs | M0202L | ||
T4 Polynucleotide Kinase | New England Biolabs | M0201L | ||
α-digoxigenin Fab | Roche | 11214667001 | ||
Tosyl Activated Beads | Dynal/Invitrogen | 142-03 | ||
Magnetic Separator | Invitrogen | Dynal MPC | ||
3-aminopropyl-triethoxysilane | Sigma | A3648 | Other aminosilanes can be used or mixed with non-amine reactive silanes for sparser surfaces | |
Succinimidyl propionate PEG | Nektar | Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc. | ||
Biotin-PEG-NHS | Nektar | Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc. | ||
Double-sided tape | Grace BioLabs | SA-S-1L | 100 μm thickness | |
Quartz slide | Technical Glass | 20 mm (W)x 50 mm (L)x 1mm (H) | Size to fit on coverslips. Drill holes with diamond-tip drill bits (DiamondBurs.net) | |
Polyethylene tubing | Becton Dickinson | 427416 | 0.76 mm ID, 1.22 OD Other size tubing can be substituted. |
|
Streptavidin | Sigma | S4762 | Make 1 mg/mL solution, 25 μL aliquots in PBS pH 7.3 | |
Deoxyribonucleotide triphosphate solution mix | New England Biolabs | N0447 | ||
Inverted Optical Microscope with 10X Objective | Olympus | Olympus IX-51 | ||
Permament rare-earth magnet | National Imports | www.rare-earth-magnets.com | ||
CCD Camera | QImaging | Rolera-XR Fast 139 | ||
Syringe Pump | Harvard Apparatus | 11 Plus | Operate in refill mode to facilitate solution changes | |
Fiber Illuminator | Thorlabs Inc. | OSL1 |