Waiting
Login-Verarbeitung ...

Trial ends in Request Full Access Tell Your Colleague About Jove

Neuroscience

Measurement of Poly A Tail Length from Drosophila Larva Brain and Cell Line

Published: January 12, 2024 doi: 10.3791/66116

Summary

The protocol describes an efficient and reliable method for quantifying the poly(A) length of the gene of interest from the Drosophila nervous system, which can be easily adapted to tissues or cell types from other species.

Abstract

Polyadenylation is a crucial posttranscriptional modification that adds poly(A) tails to the 3' end of mRNA molecules. The length of the poly(A) tail is tightly regulated by cellular processes. Dysregulation of mRNA polyadenylation has been associated with abnormal gene expression and various diseases, including cancer, neurological disorders, and developmental abnormalities. Therefore, comprehending the dynamics of polyadenylation is vital for unraveling the complexities of mRNA processing and posttranscriptional gene regulation.

This paper presents a method for measuring poly(A) tail lengths in RNA samples isolated from Drosophila larval brains and Drosophila Schneider S2 cells. We employed the guanosine/inosine (G/I) tailing approach, which involves the enzymatic addition of G/I residues at the 3' end of mRNA using yeast poly(A) polymerase. This modification protects the RNA's 3' end from enzymatic degradation. The protected full-length poly(A) tails are then reverse-transcribed using a universal antisense primer. Subsequently, PCR amplification is performed using a gene-specific oligo that targets the gene of interest, along with a universal sequence oligo used for reverse transcription.

This generates PCR products encompassing the poly(A) tails of the gene of interest. Since polyadenylation is not a uniform modification and results in tails of varying lengths, the PCR products display a range of sizes, leading to a smear pattern on agarose gel. Finally, the PCR products are subjected to high-resolution capillary gel electrophoresis, followed by quantification using the sizes of the poly(A) PCR products and the gene-specific PCR product. This technique offers a straightforward and reliable tool for analyzing poly(A) tail lengths, enabling us to gain deeper insights into the intricate mechanisms governing mRNA regulation.

Introduction

Most eukaryotic mRNAs are posttranscriptionally polyadenylated at their 3′ terminus in the nucleus by the addition of non-templated adenosines by canonical poly(A) polymerases. An intact poly(A) tail is pivotal throughout the lifecycle of mRNA, as it is essential for mRNA nuclear export1, facilitates interaction with poly(A)-binding proteins to enhance translational efficiency2, and imparts resistance against degradation3. In certain cases, the poly(A) tail can also undergo extension in the cytoplasm, facilitated by noncanonical poly(A) polymerases4. In the cytoplasm, poly (A) tail length dynamically changes and influences the life span of the mRNA molecule. Numerous polymerases and deadenylases are known for modulating tail length5,6,7. For example, the shortening of poly(A) tails correlates with translational repression, whereas the lengthening of poly(A) tails enhances translation8,9.

Accumulating genomic studies have demonstrated the fundamental significance of the poly(A) tail length across various facets of eukaryotic biology. This includes roles in germ-cell development, early embryonic development, neuronal synaptic plasticity for learning and memory, and the inflammatory response10. There have been numerous methods and assays developed for measuring poly(A) tail lengths. For example, the RNase H/oligo(dT) assay takes advantage of RNase H in the presence or absence of oligo(dT) to study poly(A) tail length11,12. Other methods to study poly(A) tail include the PCR amplification of 3' ends such as rapid amplification of cDNA ends poly(A) test (RACE-PAT)12,13 and the ligase-mediated poly(A) test (LM-PAT)14. Further modifications of the PAT assay include ePAT15 and sPAT16. Enzymatic G-tailing17,18 or G/I-tailing of the 3' end are other variations of the PAT assay. Further modification of these techniques includes the use of fluorescently labeled primers along with capillary gel electrophoresis for high-resolution analysis, referred to as the high-resolution poly(A) test (Hire-PAT)19. These PCR-driven assays allow fast and high-sensitivity poly(A) length quantitation.

With the development of next-generation sequencing, a high-throughput sequencing method, such as PAL-seq20 and TAIL-seq21, allows polyadenylation analyses at a transcriptome-wide scale. However, these methods provide only short sequencing reads of 36-51 nucleotides. Therefore, FLAM-Seq22 was developed for global tail length profiling of full-length mRNA and provides long reads. Nanopore technology23 provides PCR-independent, direct RNA, or direct cDNA sequencing for poly(A) tail length estimations. However, these high-throughput methods are not without limitations. They require large amounts of starting materials, are expensive, and time-consuming. Moreover, analyzing rare transcripts can be extremely challenging with high-throughput methods, and low-throughput PCR-based methods still provide an advantage when a small number of transcripts need to be analyzed, for pilot experiments, and validation of other methods.

We have recently demonstrated that Dscam1 mRNAs contain short poly(A) tails in Drosophila, which necessitates a non-canonical binding of the cytoplasmic poly(A)-binding protein on Dscam1 3'UTR using the G/I tailing method24. Here we provide a streamlined procedure for tissue preparation and quantifying poly(A) length of mRNAs from the Drosophila nervous system and Drosophila S2 cells.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Rearing and selecting Drosophila larvae

  1. Maintain/culture the fly strain (w1118, wildtype) on standard fly food medium at 25 ˚C in a humidified incubator.
  2. Select 10 wandering 3rd instar larvae 72 h after egg laying.
  3. Place the larvae in a 35 mm empty Petri dish and gently wash them by transferring the larvae to the new dish containing tap water using forceps. Do this 2x to remove any remaining food.

2. Brain isolation from Drosophila larvae (Figure 1)

Figure 1
Figure 1: Dissection of Drosophila larval brain from 3rd instar wandering stage. (A) Schematic drawings of Drosophila larva. (B-G) Larva dissection. Please click here to view a larger version of this figure.

  1. Place 10 larvae on a dissection dish containing ice-cold PBS.
  2. Place the larva dorsal side up (identified by tracheal tubes running along its length) and pin each end to the bottom of the dish followed by making a small incision on the body wall at the posterior end.
  3. Cut the body wall along the dorsal midline towards the anterior end using microdissection scissors.
  4. Briefly flush the interior of the larva using a Pasteur pipette 3x with PBS in the dish to expose the brain.
  5. Locate and lift the brain using the forceps and carefully isolate it using microdissection scissors.
  6. Transfer the dissected brains to a 1.5 mL microcentrifuge tube filled with ice-cold PBS on ice; collect all larva brains. Proceed with RNA extraction using an RNA microprep kit as described in section 4.
    NOTE: Do a dissection of 10 larvae within 15 min to prevent tissue damage and RNA degradation.

3. Drosophila S2 Schneider cells

  1. Grow Drosophila S2 cells in Drosophila Schneider's medium supplemented with 10% fetal bovine serum (FBS) at 25 °C in a humidified incubator to a density of 8 × 106 to 10 × 106 cells/mL with minimum 90% viability.
  2. In a 50 mL sterile conical tube, dilute cells to 2.5 × 106 cells/mL with Schneider's Drosophila medium supplemented with 10% FBS that has been prewarmed to 25 °C.
  3. Transfer 8 mL of the cell suspension (20 × 106 cells) into a 100 mm culture plate and add 4 mL of medium to make it to 12 mL (day 1).
  4. Incubate the cultured cells at 25 °C in a humidified incubator.
    NOTE: Cells loosely adhere to the plate after 12-16 h (day 2).
  5. Transfect the cells with appropriate DNA plasmids24.
  6. Incubate for 48 h in a humidified incubator.
  7. After incubation, collect cells by adding 5 mL of ice-cold PBS by gentle pipetting (day 4).
  8. Transfer the cells to a 15 mL tube.
  9. Pellet the cells by centrifuging at 1,000 × g for 5 min at 4 °C.
  10. Rinse the cells 2x with ice-cold PBS by gentle pipetting and collect the cells by centrifuging them at 1,000 × g for 5 min at 4 °C.
  11. Perform RNA extraction using an RNA miniprep kit.
    NOTE: Perform the following steps inside a sterile laminar flow hood.

4. Total RNA extraction from Drosophila larvae brain and S2 cells

  1. Larval brain: Remove PBS by brief centrifugation (8 s short spin at 5,000 × g).
  2. Add 600 µL of RNA lysis buffer and homogenize 10x with a plastic pestle. Visually inspect the tube under a stereo microscope to ensure complete lysis.
  3. Centrifuge at 1,000 × g for 5 min at 4 °C to remove tissue debris. Transfer the cleared supernatant into a nuclease-free microcentrifuge tube.
  4. Isolate RNA using an RNA microprep kit according to the manufacturer's instructions.
    NOTE: The use of an RNA microprep kit is essential for the larval brain samples because of the small amount of RNA present in the samples.
  5. S2 cells: Remove PBS and isolate RNA according to the manufacturer's instructions.
  6. Measure RNA yield and quality by spectrophotometry and agarose gel electrophoresis.
    1. Determine the purity and quantity of extracted RNA by measuring the optical density of the extracted RNA at A260 nm and A280 nm, respectively. Make sure the A260 nm/A280 nm ratio is ≥2.0 and the RNA concentration is >350 ng/µL for downstream applications.
      NOTE: A typical RNA yield from 10 Drosophila larva brains is ~500-800 ng/µL or 2.5-4 µg in 5 µL. For S2 cells, the yield is ~2-3 µg/µL (15-30 µg in 15 µL). Isolated RNA can be stored at -80 °C for long-term storage.

5. Preparation of RNA gel and electrophoresis

  1. 1.5% Denaturing RNA gel (100 mL)
    NOTE: Formaldehyde is toxic through skin contact and inhalation of vapors; handle it in a chemical fume hood.
    1. Dissolve three agarose tablets (1.5 g) in 82 mL of MOPS buffer (Supplemental File 1) until tablets completely break up to form fine particles.
    2. Heat the agarose slurry in a microwave until the solution is clear and all particles are completely dissolved.
    3. Cool the solution to ~60 °C.
    4. Add 18 mL of 37% formaldehyde, then mix by gentle swirling. Pour the solution into the casting tray and let it solidify in a fume hood.
  2. RNA sample preparation and electrophoresis
    1. Dilute the RNA sample to 200 ng (in 5 µL) and add 5 µL of 2x RNA loading dye.
    2. Heat the samples at 70 ˚C for 5 min in a dry bath.
    3. Load 2 µL of RNA ladder in the first lane and 10 µL of samples in the adjacent lanes.
    4. Perform electrophoresis in MOPS buffer at 100 V for 60 min for a 5 x 6 cm gel.
      NOTE: Adjust the electrophoresis conditions depending on the amplicon sizes.
    5. Visualize the gel on a UV transilluminator.
      NOTE: The presence of a single band ~600 nucleotide size indicates intact RNA preparation (see Figure 2A).

6. Poly(A) tail length measurement

Figure 2
Figure 2: RNA sample preparation and the poly(A)-tail assay. (A) The RNA gel images show total RNA from the Drosophila larva brain (left) and S2 cells (right) on a 1.5% formaldehyde agarose gel. Single-stranded RNA ladder sizes are shown in nucleotides on lane M. Note a major RNA banding at ~600 nt, which is from rRNA. (B) Schematics of poly(A)-tail assay. Abbreviation: G/I = guanosine/inosine. Please click here to view a larger version of this figure.

  1. GI tailing (Figure 2B)
    1. Keeping the reagents on ice, prepare the following mixture (20 µL): up to 14 µL of total RNA sample (1 µg), 4 µL of 5x Tail buffer mix, and 2 µL of 10x Tail enzyme mix.
    2. Incubate at 37 °C for 60 min in a thermocycler.
    3. Add 1.5 µL of the tail stop solution; keep on ice for 2 min.
      NOTE: Proceed to reverse transcription or store the GI-tailed RNA samples at -80 °C until ready to proceed to reverse transcription.
  2. Reverse transcription and PCR amplification
    1. Synthesize cDNA by preparing the mix and incubating it under the conditions described in Supplemental File 1.
    2. Dilute the cDNA samples and perform PCR to amplify DNA as indicated in Supplemental File 1.

7. PCR product analysis by agarose gel electrophoresis

  1. Analyze a small portion (2-5 µL) of the PCR products from step 6.2.2 on a 2.5% agarose gel by electrophoresis at 100 V for 45 min for quality control.
  2. Verify the specificity of PCR for gene-specific and tail-specific reactions by sequencing the gel-extracted PCR bands.

8. Capillary electrophoresis

  1. Perform high-resolution gel electrophoresis on 1 µL of PCR products (0.5-5 ng/µL) from gene-specific and poly(A)-specific PCR using the bioanalyzer with a high-sensitivity DNA kit. Look for well-resolved peaks indicating a successful run.

9. Data analysis: poly(A) tail length measurement (Figure 3)

Figure 3
Figure 3: Poly(A) tail length and peak value measurement. Please click here to view a larger version of this figure.

  1. Accessing data
    1. To access the data, open the xad file in the software.
    2. Select the sample name or the ladder in the tree view panel.
      NOTE: This will show the result as electropherograms or gel-like images for the selected samples. The lower marker 35 base pair (bp) and upper marker 10,380 bp are the internal standards used to align the ladder data (50-7,000 bp) with data from the sample wells.
    3. Zoom in and out of the electropherograms and gel-like images to display the details.
  2. Performing peak and smear analysis
    1. To obtain the peak sizes, open the electropherogram of a selected sample.
    2. Right-click on the electropherogram and select manual integration to manually select peaks by dragging the horizontal line.
    3. Observe the peak values in the Peak table. Identify the peak with the largest Peak Height. This is a peak of poly(A) tail length for an individual sample. In the example shown, it is 346 bp.
    4. Enable the Show/Hide Setpoints icon on the top menu and wait for a new panel to pop up on the right side.
    5. Select Advanced, scroll down to find Perform Smear Analysis, and select the check box. This will add the Region table to the electropherogram tab.
    6. Select an electropherogram from a sample and go to the Region table, which shows the From [bp] and To [bp] menu. To set the starting and ending [bp], right-click on the electropherogram and select Region to add Add Region.
    7. Right-click on any cells in the Region table and select Modify Regions to make a small new window pop up where custom regions can be set.
      NOTE: For example, we used a region of 300 bp to 550 bp for GAPDH. The gene-specific GAPDH PCR yielded a peak at 265 bp. The universal primer (Table 1) extends the length of poly(A) PCR by 35 bp via annealing to G/I-tailed RNAs. Thus, the first adenine nucleotide on GAPDH RNA starts at 300 bp (265 + 35). We arbitrarily limited the maximum poly(A) tail length to 250 (300 + 250 = 550). From the region table, the program returns the average size within the region as 387 bp.
    8. Use equation (1) to calculate the poly(A) tail length on the mRNA of interest:
      Poly(A) tail length = (A - B - 35) (1)
      Where A is the average bp of poly(A)-specific PCR product from electropherogram (i.e., 387 bp for GAPDH), B is the peak bp of gene-specific PCR product from electropherogram (i.e., 265 bp for GAPDH), and "35" is the length of universal reverse primer tag.
      NOTE: From the calculation above, the average poly(A) tail length of GAPDH is 387 - 265 - 35= 87 bp.

10. Visualizing poly(A) tail length distribution

  1. Export data as a csv file under File | Export | Sample Data to retrieve sample data.
    NOTE: The exported csv file displays run time rather than bp on the X-axis.
  2. Go to an electropherogram of a sample and check on Show Sizes on the Electropherogram tab to automatically convert the region table on Region Table from bp to run time. In the example, 70.39 s to 86.28 s correspond to 300 bp to 550 bp.
  3. Open the csv file and select the values from 70.39 s to 86.28 s of run time to generate a graph. To visualize bp sizes to the X-axis on the graph, export the electropherogram with bp sizes as an image file and overlay it on the graph generated in the spreadsheet. This will appropriately match the bp sizes on poly(A) tail distribution.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Here, we analyzed the poly(A) tail length of Dscam1 and GAPDH from Drosophila larval brains (Figure 4). Isolated RNAs were visualized on an agarose gel for quality control. A single RNA band at around 600 nucleotide size indicates intact RNA preparation (Figure 2A). RNAs were subjected to the G/I tailing and high-resolution capillary electrophoresis using an Agilent 2100 bioanalyzer. The gel images were exported using the Agilent 2100 Expert Software and assembled accordingly. The PCR products from GAPDH and Dscam1 gene-specific primer pairs showed a distinct single band while those from the gene-specific/universal primer pairs showed distinct smear patterns (Figure 4A and Table 1), which indicates differential poly(A) length of GAPDH and Dscam1 mRNAs. In Figure 4B, the smear analysis was used to obtain average poly(A) tail lengths from GAPDH and Dscam1. The electropherograms were exported and modified to represent the poly(A) tail lengths (Figure 4C).

Similarly, we performed a poly(A) tail length analysis on S2 cells (Figure 5). To determine the role of Dscam1 3'UTR in shortening poly(A) tails, S2 cells were transfected with the DNA plasmids containing Dscam1 coding region with either SV40 3'UTR or Dscam1 3'UTR. The minimum SV40 3'UTR was selected for control of Dscam1 3'UTR since SV40 3'UTR has been widely used as a minimum transcription termination and polyadenylation signal for recombinant DNA plasmids. Total RNA was extracted and subjected to RT-PCR, G/I tailing, and high-resolution capillary electrophoresis (Figure 5). The result shows that the poly(A) tail length distribution from the SV40 3'UTR plasmid followed a similar pattern as that of endogenous GAPDH while the poly(A) tail length distribution from the Dscam1 3'UTR plasmid followed a similar pattern as that of endogenous Dscam1 mRNA from the larval brains.

Figure 4
Figure 4: Poly(A) tail length measurement of GAPDH and Dscam1 from the larval brains. (A) Capillary gel electrophoresis resolves the gene-specific PCR product as a discrete band (first and second lanes) for GAPDH2 and Dscam1. The PCR product using universal reverse primer shows a smear distribution (third and fourth lane). * non-specific band. (B) The average poly(A)-tail lengths were calculated using the smear analysis. (C) The distribution of poly(A) tail length was reconstructed from the exported csv file. Please click here to view a larger version of this figure.

Figure 5
Figure 5: Poly(A) tail length measurement of transfected Dscam1 DNA plasmid. Cultured Drosophila S2 cells were co-transfected with the Dscam1 constructs that contain the coding region of Dscam1, and the 3′UTR of either Dscam1 or SV40. (A) Capillary gel electrophoresis images are shown for the gene-specific PCR product as a discrete band (first and second lanes) for SV40 (Dscam1-SV40 3'UTR) and Dscam1 (Dscam1-Dscam1 3'UTR). The PCR product using universal reverse primer shows a smear pattern (third and fourth lanes). * non-specific band. (B) The average poly(A)-tail lengths were calculated using the smear analysis. (C) The poly(A) tail length distribution was reconstructed from the exported csv file. Please click here to view a larger version of this figure.

Dscam1
Forward Primer (5’-3’) CGCAGCCACAACAATTGAATG
Reverse Primer (5’-3’) AAATAAAATCAAAATCATATATTTAGCAACTTATGAAC
SV40
Forward Primer (5’-3’) CCACAAAGGAAAAAGCTGCAC
Reverse Primer (5’-3’) TTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTG
GAPDH
Forward Primer (5’-3’) CACTTCAGAAACGGCCTGAAAATGGC
Reverse Primer (5’-3’) AATATTTAAATGCTTATGAGTCGGCATTTTTAAAACTAC
Universal reverse primer
Reverse Primer (5’-3’) GGTAATACGACTCACTATAGCGAGACCCCCCCCCCTT

Table 1: Primers used in this protocol.

Supplemental File 1: Composition of solutions and PCR setup. Please click here to download this File.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

In this protocol, we describe the technique to dissect the Drosophila larval brain from wandering 3rd instar stage as well as the sample preparation from Drosophila S2 cells. Due to the labile nature of mRNAs, sample collection requires extra caution. For larval brain dissection, brains should not be damaged during isolation and should not be kept in solution for a prolonged duration. Keeping dissection time to 8-10 min for a round of dissection is essential. It may also be beneficial to supplement the dissection solution with RNAase inhibitors. As for the S2 cell culturing and transfection, carry out all steps in the laminar flow hood.

The RNA isolation step requires additional consideration. We recommend using a laminar flow type clean space that is pretreated with RNase-removing solutions. Apart from RNA yield, it is essential to check the RNA integrity to ensure that the sample has not been degraded during the dissection and isolation steps. RNA integrity can be visualized by denaturing agarose gel electrophoresis. The total RNA from Drosophila exhibits a single banding profile because 28S rRNA is dissociated into two equally sized subunits, which comigrates with the 18S rRNA25. This can be seen as a single band of around 600 nucleotides when using a single-stranded RNA ladder (Figure 2A).

Isolated RNA samples are subjected to the G/I tailing (Figure 2B). Guanosine and inosine residues are added at the 3′-end of RNAs by yeast poly(A) polymerase (PAP)17, which preserves the 3′-end of RNA from enzymatic degradation. The newly synthesized G/I-tag-protected full-length RNAs are reverse-transcribed to yield cDNA samples using the universal reverse primer (3'-tagged C10T2). Followed by a PCR with the gene-specific forward/reverse primers right upstream of the polyadenylation site to generate a PCR product that shows a sharp band. The PCR reactions from a gene-specific forward and the universal reverse primers generate undefined lengths of DNA molecules as a smear on the gel, which reflects varying lengths of poly(A) tails. The PCR products were subsequently analyzed by capillary gel electrophoresis.

When designing primers, it is important to note that the amplicon size with gene-specific forward/reverse primers should be in the range of 50-300 bp. Testing multiple forward primers gives an opportunity to find the best primer that works for poly(A) tail assessment. We recommend designing a reverse primer for gene-specific products just upstream of the predicted poly(A) start site because this provides an opportunity for straightforward calculation of the poly(A) tail lengths. When running PCR reactions, it is important to perform a "no reverse transcriptase control" to rule out amplification from contaminated genomic DNA. PCR optimization with an annealing temperature gradient is highly recommended. Given the nature of this methodology, analyzing poly(A) tail lengths of alternatively polyadenylated mRNA species requires additional consideration. For example, many genes undergo alternative polyadenylation to generate different 3'UTR species26. We recommend using different PCR primer sets to study individual 3'UTR species.

We highly recommend including the gene-specific PCR product on capillary gel electrophoresis in each run since there is a potential migration difference of a few nucleotides in each run. It is essential that the actual base pair size of the gene-specific PCR is used rather than the theoretical sizes when calculating poly(A) tail length.

Some RNAs undergo additional posttranscriptional modifications, including terminal uridylation27. The G/I tailing method may not be suitable for measuring poly(A) tail length when the mRNA is uridylated. This is because the universal reverse primer may not efficiently amplify the mRNA species that has non adenine nucleotides at its 3'-end. The G/I tailing is a PCR-based method, which potentially creates unwanted bias by amplifying shorter fragments more efficiently. Thus, users should be cautious when interpreting the result.

Using the method presented here, we demonstrated that the G/I tailing can be efficiently used to measure poly(A) tail length from the Drosophila nervous system and S2 cells. The method is highly quantitative when coupled with capillary electrophoresis. While high-throughput analyses provide global poly(A) tail analysis, the low-throughput PCR-based method G/I tailing is still very useful for single-transcript analysis, pilot experiments, and validation of other methods. In summary, the choice of method depends on the specific research questions and goals. Researchers should select the method that best suits their experimental needs and resources.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

The authors have no conflicts of interest to disclose.

Acknowledgments

This study was supported by the National Institute of Neurological Disorders and Stroke Grant R01NS116463 to J.K., and the Cellular and Molecular Imaging Core facility at the University of Nevada, Reno, which was supported by National Institutes of Health Grant P20GM103650 and used for research reported in this study.

Materials

Name Company Catalog Number Comments
3-(N-morpholino) propanesulfonic acid (MOPS) Research Product Internation (RPI) M92020
Agilent High Sensitivity DNA Kit Agilent Technologies  5067-4626
Agilent software 2100 expert free download demo Agilent Technologies https://www.agilent.com/en/product/automated-electrophoresis/bioanalyzer-systems/bioanalyzer-software/2100-expert-software-228259
Apex 100 bp-Low DNA Ladder Genesee Scientific 19-109
Bioanalyzer Agilent 2100 Bioanalyzer G2938C
Diethyl pyrocarbonate (DEPC) Research Product Internation (RPI)  D43060
DNA dye (Gel Loading Dye, Purple (6x) New England biolabs  B7024S
Drosophila S2 cell line Drosophila Genomics Resource Center stock #181
Drosophila Schneider’s Medium Thermo Fisher Scientific 21720024
Ehidium bromide Genesee scientific  20-276
Fetal bovine serum (FBS) Sigma-Aldrich F4135
Forceps Dumont 5   Fine Science tools  11254-20
Nuclease free water Thermo Fisher Scientific  AM9932
PBS 10x Research Product Internation (RPI)  P32200
Poly(A) Tail-Length Assay Kit Thermo Fisher Scientific  764551KT
RiboRuler Low Range RNA Ladder Thermo Fisher Scientific  SM1833
RNA Gel Loading Dye (2x) Thermo Fisher Scientific  R0641
RNA microprep kit Zymoresearch  R1050 
RNA miniprep kit Zymoresearch  R1055
Scissors-Vannas Spring Scissors - 2.5 mm Cutting Edge Fine Science tools  15000-08
TopVision Agarose Tablets Thermo Fisher Scientific R2802
Tris-Acetate-EDTA (TAE) Thermo Fisher Scientific B49

DOWNLOAD MATERIALS LIST

References

  1. Stewart, M. Polyadenylation and nuclear export of mRNAs. Journal of Biological Chemistry. 294 (9), 2977-2987 (2019).
  2. Machida, K., et al. Dynamic interaction of poly(A)-binding protein with the ribosome. Scientific Reports. 8 (1), 17435 (2018).
  3. Eisen, T. J., et al. The dynamics of cytoplasmic mRNA metabolism. Molecular Cell. 77 (4), 786-799 (2020).
  4. Liudkovska, V., Dziembowski, A. Functions and mechanisms of RNA tailing by metazoan terminal nucleotidyltransferases. Wiley Interdisciplinary Reviews RNA. 12 (2), e1622 (2021).
  5. Goldstrohm, A. C., Wickens, M. Multifunctional deadenylase complexes diversify mRNA control. Nature Reviews Molecular Cell Biology. 9 (4), 337-344 (2008).
  6. Schmidt, M. J., Norbury, C. J. Polyadenylation and beyond: emerging roles for noncanonical poly(A) polymerases. Wiley interdisciplinary reviews RNA. 1 (1), 142-151 (2010).
  7. Laishram, R. S. Poly(A) polymerase (PAP) diversity in gene expression - Star-PAP vs canonical PAP. FEBS Letters. 588 (14), 2185-2197 (2014).
  8. Salles, F. J., Lieberfarb, M. E., Wreden, C., Gergen, J. P., Strickland, S. Coordinate initiation of Drosophila development by regulated polyadenylation of maternal messenger RNAs. Science. 266 (5193), 1996-1999 (1994).
  9. Wreden, C., Verrotti, A. C., Schisa, J. A., Lieberfarb, M. E., Strickland, S. Nanos and pumilio establish embryonic polarity in Drosophila by promoting posterior deadenylation of hunchback mRNA. Development. 124 (15), 3015-3023 (1997).
  10. Passmore, L. A., Coller, J. Roles of mRNA poly(A) tails in regulation of eukaryotic gene expression. Nature Reviews Molecular Cell Biology. 23 (2), 93-106 (2021).
  11. Murray, E. L., Schoenberg, D. R. Assays for determining poly(a) tail length and the polarity of mRNA decay in mammalian cells. Methods in Enzymology. 448, 483-504 (2008).
  12. Salles, F. J., Strickland, S. Analysis of poly(a) tail lengths by PCR: The PAT assay. Methods in Molecular Biology. 118, 441-448 (1999).
  13. Salles, F. J., Darrow, A. L., O'Connell, M. L., Strickland, S. Isolation of novel murine maternal mRNAs regulated by cytoplasmic polyadenylation. Genes and Development. 6 (7), 1202-1212 (1992).
  14. Salles, F. J., Strickland, S. Rapid and sensitive analysis of mRNA polyadenylation states by PCR. Genome Research. 4 (6), 317-321 (1995).
  15. Janicke, A., Vancuylenberg, J., Boag, P. R., Traven, A., Beilharz, T. H. ePAT: A simple method to tag adenylated RNA to measure poly(a)-tail length and other 3' RACE applications. RNA. 18 (6), 1289-1295 (2012).
  16. Minasaki, R., Rudel, D., Eckmann, C. R. Increased sensitivity and accuracy of a single-stranded DNA splint-mediated ligation assay (sPAT) reveals poly(a) tail length dynamics of developmentally regulated mRNAs. RNA Biology. 11 (2), 111-123 (2014).
  17. Martin, G., Keller, W. Tailing and 3'-end labeling of RNA with yeast poly(A) polymerase and various nucleotides. RNA. 4 (2), 226-230 (1998).
  18. Kusov, Y. Y., Shatirishvili, G., Dzagurov, G., Verena, G. M. A new G-tailing method for the determination of the poly(a) tail length applied to hepatitis a virus RNA. Nucleic Acids Research. 29 (12), 57 (2001).
  19. Bazzini, A. A., Lee, M. T., Giraldez, A. J. Ribosome profiling shows that miR-430 reduces translation before causing mRNA decay in zebrafish. Science. 336 (6078), 233-237 (2012).
  20. Subtelny, A. O., Eichhorn, S. W., Chen, G. R., Sive, H., Bartel, D. P. Poly(a)-tail profiling reveals an embryonic switch in translational control. Nature. 508 (1), 66-71 (2014).
  21. Chang, H., Lim, J., Ha, M., Kim, V. N. TAIL-seq: Genome-wide determination of poly(a) tail length and 3' end modifications. Molecular Cell. 53 (6), 1044-1052 (2014).
  22. Legnini, I., Alles, J., Karaiskos, N., Ayoub, S., Rajewsky, N. FLAM-seq: Full-length mRNA sequencing reveals principles of poly(A) tail length control. Nature Methods. 16 (9), 879-886 (2019).
  23. Garalde, D. R., et al. Highly parallel direct RNA sequencing on an array of nanopores. Nature Methods. 15 (3), 201-206 (2018).
  24. Singh, M., Ye, B., Kim, J. H. Dual leucine zipper kinase regulates Dscam expression through a noncanonical function of the cytoplasmic poly(A)-binding protein. Journal of Neuroscience. 42 (31), 6007-6019 (2022).
  25. Macharia, R. W., Ombura, F. L., Aroko, E. O. Insects' RNA profiling reveals absence of "hidden break" in 28S ribosomal RNA molecule of onion thrips, Thrips tabaci. Journal of Nucleic Acids. 2015, 965294 (2015).
  26. Miura, P., Sanfilippo, P., Shenker, S., Lai, E. C. Alternative polyadenylation in the nervous system: to what lengths will 3' UTR extensions take us. Bioessays. 36 (8), 766-777 (2014).
  27. Sement, F. M., et al. et al Uridylation prevents 3' trimming of oligoadenylated mRNAs. Nucleic Acids Research. 41 (14), 7115-7127 (2013).

Tags

Neuroscience
Measurement of Poly A Tail Length from <em>Drosophila</em> Larva Brain and Cell Line
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Singh, M., Kim, J. H. Measurement of More

Singh, M., Kim, J. H. Measurement of Poly A Tail Length from Drosophila Larva Brain and Cell Line. J. Vis. Exp. (203), e66116, doi:10.3791/66116 (2024).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter