This protocol describes how to build a continuous-flow-polymerase chain system based on a microfluidic chip and how to build a capillary electrophoresis system in the lab. It presents a simple method for the analysis of nucleic acids in the lab.
Polymerase chain reaction (PCR) is a traditional method employed for the amplification of a target gene that has played an important role in biomolecular diagnostics. However, traditional PCR is very time-consuming because of the low-temperature variation efficiency. This work proposes a continuous-flow-PCR (CF-PCR) system based on a microfluidic chip. The amplification time can be greatly reduced by running the PCR solution into a microchannel placed on heaters set at different temperatures. Moreover, as capillary electrophoresis (CE) is an ideal way to differentiate positive and false-positive PCR products, a CE system was built to achieve efficient separation of the DNA fragments. This paper describes the process of amplification of Escherichia coli (E. coli) by the CF-PCR system built in-house and the detection of the PCR products by CE. The results demonstrate that the target gene of E. coli was successfully amplified within 10 min, indicating that these two systems can be used for the rapid amplification and detection of nucleic acids.
Polymerase chain reaction (PCR) is a molecular biology technique used to amplify specific DNA fragments, thereby amplifying trace amounts of DNA hundreds of millions of times. It has been widely used in clinical diagnosis, medical research, food safety, forensic identification, and other fields. The PCR process mainly consists of three steps: denaturation at 90-95 °C, annealing at 50-60 °C, and extension at 72-77 °C. Thermal cycling is an important part of the PCR process; however, the traditional PCR thermal cycler is not only bulky but also inefficient, requiring approximately 40 min to complete 25 cycles. To overcome these limitations, a continuous-flow PCR (CF-PCR) system was built in-house, based on a microfluidic chip. CF-PCR can greatly save time by driving the PCR solution into microchannels placed on heaters at different temperatures1,2,3,4,5.
As capillary electrophoresis (CE) has many advantages, such as high resolution, high speed, and excellent reproducibility6,7,8,9,10,11, it has become a popular tool in the lab for the analysis of nucleic acids and proteins. However, most labs, especially labs in the developing world, cannot afford this technology because of the high price of the CE instrument. Herein, we have outlined protocols for how to fabricate the CF-PCR microfluidic chip and how to build a versatile CE system in the lab. We also demonstrate the process of amplification of E. coli by this CF-PCR system and the detection of the PCR products by the CE system. By following the procedures described in this protocol, users should be able to fabricate microfluidic chips, prepare PCR solutions, build a CF-PCR system for nucleic acid amplification, and set up a simple CE system, even with limited resources, to separate DNA fragments.
NOTE: See the Table of Materials for details related to all materials, reagents, and equipment used in this protocol.
1. Fabrication of CF-PCR microfluidic chip
2. Preparation of the PCR solution
3. Construction of the CF-PCR system
4. Construction of the CE system
5. Run the PCR solution
6. Detection of the PCR products by this CE system built in-house
Figure 5 represents the electropherogram of the PCR products and the DNA markers. Trace (Figure 5A) is the CE result of the CF-PCR amplified product, trace (Figure 5B) is the CE result of the product amplified by thermal cycling, and trace (Figure 5C) is the CE result of the 100 bp DNA ladder. We first amplified the target gene of E. coli in the CF-PCR system; the PCR solution took ~10 min, 30 s from the inlet to the outlet of the chip. The size of the target amplicon of E. coli was 544 bp. The amplified PCR products were analyzed in the CE system, and CE of a 100 bp DNA ladder was also performed under the same experimental conditions. The size of the PCR product can be evaluated according to the electropherogram of the DNA ladder. Each experiment was performed three times for reproducibility. The data in Figure 5 show that the peaks corresponding to the PCR products of E. coli were observed after separation, and the migration times of the PCR products in the microfluidic chip were consistent with the one in a thermal cycler.
Figure 1: The cleaned silicon wafer. Scale bar = 1 cm. Please click here to view a larger version of this figure.
Figure 2: The CF-PCR microfluidic chip made using PDMS. The microchannels were filled with red ink for visualization. Scale bar = 1 cm. Abbreviations: CF-PCR = continuous-flow-PCR; PDMS = polydimethysiloxane. Please click here to view a larger version of this figure.
Figure 3: The CF-PCR system. (1) Microfluidic chip, (2) PTC ceramic heater, (3) syringe, (4) pump, (5) silicone tubing, (6) slot, (7) steel needle, (8) pipette tip, (9) PID temperature controller, (10) temperature sensor, (11) solid-state relay. Abbreviation: CF-PCR = continuous-flow-PCR. Please click here to view a larger version of this figure.
Figure 4: The construction of the CE system. Abbreviations: CE = capillary electrophoresis; PMT = photomultiplier tube; A1, A2 = filters; B = field lens; C = dichroic mirror. Please click here to view a larger version of this figure.
Figure 5: The electropherogram of Escherichia coli. Amplification by (A) CF-PCR microfluidic chip, (B) traditional PCR thermal cycler, and (C) DNA markers. Abbreviation: CF-PCR = continuous-flow-PCR. Please click here to view a larger version of this figure.
Target | Sequence 5′……3′ | Amplicon (bp) | ||
EC-F | GGAAGAAGCTTGCTTCTTTGCTGAC | 544 | ||
EC-R | AGCCCGGGGATTTCACATCTGACTTA |
Table 1: Primers employed for Escherichia coli. Abbreviations: EC = Escherichia coli; F = forward; R = reverse.
10x Fast Buffer I | 5.0 μL |
dNTP mixture (2.5 μM) | 4.0 μL |
SpeedSTAR HS DNA Polymerase | 0.25 μL |
polyvinyl pyrrolidone (PVP) | 3.5 μL |
Tween 20 | 1.5 μL |
template | 1.0 μL |
EC-F | 0.5 μL |
EC-R | 0.5 μL |
ultrapure water | 33.75 μL |
Table 2: The components of the PCR solution. Abbreviations: EC = Escherichia coli; F = forward; R = reverse.
Supplemental File 1: STL file for 3D printing. Please click here to download this File.
Both PCR and CE are two popular biotechnologies in the analysis of nucleic acids. This paper describes the amplification of E. coli and the detection of the PCR products using the CF-PCR and CE systems, both built in-house. The target gene of E. coli was successfully amplified within 10 min because of the high heat transfer rates. The DNA fragments smaller than 1,500 bp were separated within 8 min (Figure 5). The great advantage of these two techniques is that it can greatly save time compared to the traditional PCR and slab gel electrophoresis methods. Researchers should bear in mind that the CF-PCR microfluidic chip needs to be cleaned after use, and the CE system should be built in a clean and black house to avoid the contamination of samples. The CF-PCR system based on the microfluidic chip and the CE system introduced in this work are easy to fabricate and may offer a simple method for the analysis of nucleic acids in the lab. However, a limitation of CF-PCR is that it can only amplify and detect only one sample at a time, which may limit its wide application; to counter this, users can develop the integrated CF-PCR and CE array microfluidic chip to solve this problem. The platform reported in this work has great potential application in the field of clinical diagnosis of infectious diseases and nucleic acid research.
The authors have nothing to disclose.
This work was supported by the Science and Technology Commission of Shanghai Municipality, China (No. 19ZR1477500 and No.18441900400). We gratefully acknowledge financial support from the University of Shanghai for Science and Technology (No.2017KJFZ049).
100 bp DNA ladder | Takara Bio Inc. | 3422A | |
10x Fast Buffer I | Takara Bio Inc. | RR070A | |
10x TBE | Beijing Solarbio Science & Technology Co., Ltd. | T1051 | |
developer solution | Alfa Aesar, USA | L15459 | |
dNTP mixture (2.5 μM) | Takara Bio Inc. | RR070A | |
EC-F | Sangon Biotech, Shanghai, China | ||
EC-R | Sangon Biotech, Shanghai, China | ||
HEC,1300K | Sigma-Aldrich, USA | 9004-62-0 | |
isopropanol | Aladdin, Shanghai, China | 67-63-0 | |
microscope | Olympus, Japan | BX51 | |
photolithography | SUSS MicroTec, Germany | MJB4 | |
photomultiplier tube | Hamamatsu Photonics, Japan | R928 | |
photoresist | MicroChem, USA | SU-8 2075 | |
PID temperature controllers | Shanghai, China | XH-W2023 | |
plasma cleaner | Harrick Plasma | PDC-32G-2 | |
polyvinyl pyrrolidone (PVP) | Aladdin, Shanghai, China | P110608 | |
pump | Harvard Apparatus | PHD2000 | |
silicone tubing | BIO-RAD,USA | 7318210 | |
solid-state relays | KZLTD, China | KS1-25LA | |
SpeedSTAR HS DNA Polymerase | Takara Bio Inc. | RR070A | |
steel needle | zhongxinqiheng,Suzhou,China | ||
SYBR GREEN ![]() |
Solarbio, Beijing, China | SY1020 | |
temperature sensors | EasyShining Technology, Chengdu, China | TCM-M207 | |
Template (E. coli) | Takara Bio Inc. | AK601 | |
Tween 20 | Aladdin, Shanghai, China | T104863 | |
voltage power supply | Medina, NY, USA | TREK MODEL 610E |