Kortlægning Bakterielle Funktionelle Networks og spredningsveje i<em> Escherichia Coli</em> Hjælp Syntetiske Genetiske Arrays
Summary
Systematiske, store syntetiske genetiske (gen-gen eller epistasis) interaktion skærme kan bruges til at udforske genetiske redundans og pathway cross-talk. Her beskriver vi en high-throughput kvantitativ syntetisk genetisk array-screening teknologi, kaldet eSGA, som vi udviklede for at kunne belyse epistatic relationer og udforske genetiske interaktion netværk i<em> Escherichia coli</em>.
Abstract
Fænotyper bestemmes af en kompleks serie af fysiske (fx protein-protein) og funktionelt (fx gen-genet eller genetisk) interaktioner (GI) 1. Mens fysiske samspil kan angive, hvilke bakterielle proteiner er forbundet som komplekser, de ikke nødvendigvis afsløre forløb-niveau funktionelle relationships1. GI skærme, hvor væksten af dobbelte mutanter, der bærer to deleterede eller inaktiverede gener er målt og sammenlignet med de tilsvarende enkelte mutanter, kan belyse epistatisk afhængigheder mellem loci og således tilvejebringe et middel til at forespørge og opdage nye funktionelle relationer 2. Storstilede GI maps er blevet rapporteret for eukaryote organismer som gær 3-7, men GI oplysninger forbliver sparsom til prokaryoter 8, som hindrer den funktionelle annotation af bakterielle genomer. Til dette formål har vi og andre har udviklet high-throughput kvantitative bakterielle GI screeningsmetoder 9, 10 </sup>.
Her præsenterer vi de vigtigste skridt, der er nødvendige for at udføre kvantitativ E. coli Syntetisk Genetisk Array (eSGA) screening procedure på en genom-skala 9 under anvendelse af naturlige bakteriel konjugation og homolog rekombination til systemisk generere og måle egnethed stort antal dobbelte mutanter i en koloni-array format. Kort fortalt en robot til at overføre , gennem konjugation, chloramphenicol (Cm) – mærket mutantalleler fra manipuleret Hfr (Høj frekvens af rekombination) "donor stammer 'i en ordnet række af kanamycin (Kan) – mærkede F-modtager stammer. Typisk bruger vi tab af funktion enkelte mutanter, der bærer ikke-essentielle gendeletioner (fx "Keio 'indsamling 11) og væsentlige gen hypomorphic mutationer (dvs. alleler giver nedsat protein ekspression, stabilitet eller aktivitet 9, 12, 13) til forespørge de funktionelle sammenslutninger af ikke-essentielle og væsentlige gener, Respectively. Efter konjugering og efterfølgende genetisk udveksling medieret ved homolog rekombination, er de resulterende dobbelte mutanter udvælges på fast medium indeholdende begge antibiotika. Efter udvækst er pladerne digitalt afbildes og koloni størrelser er kvantitativt scoret med en intern automatiseret billedbehandlingssystem 14. Geografiske betegnelser bliver afsløret, når vækstraten for en dobbelt mutant er enten væsentligt bedre eller dårligere end forventet 9. Skærpende (eller negativ) geografiske betegnelser ofte resultere mellem tab af funktion mutationer i par af gener fra kompenserende veje, der har indvirkning på den samme væsentlige proces 2. Her, er tabet af en enkelt gen pufret, således at enten enkelt mutant er levedygtig. Men tabet af begge veje er skadelig og resulterer i syntetisk letalitet og sygdom (dvs. langsom vækst). Omvendt kan lindre (eller positive) interaktioner forekomme mellem gener i den samme vej eller proteinkompleks 2 somdeletion af begge gener alene er ofte tilstrækkelig til at forstyrre den normale funktion af vejen eller komplekse således, at yderligere perturbationer ikke svækker aktiviteten og dermed vækst, yderligere. Samlet set kan systematisk identificere og analysere GI net give uvildige, globale kort over de funktionelle relationer mellem et stort antal gener, hvorfra forløb-niveau information savnet af andre tilgange kan udledes 9.
Protocol
Representative Results
Discussion
Vi har skitseret en trinvis protokol for brug af robot eSGA screening for at undersøge bakterielle genfunktioner på en vej niveau ved forhører GI. Denne fremgangsmåde kan anvendes til at studere individuelle gener såvel som hele biologiske systemer i E. coli. Omhyggeligt udfører de eksperimentelle ovenfor beskrevne trin, herunder alle passende kontroller, og foretages en gennemgribende analyse og uafhængigt validere GI data er vigtige aspekter for succes eSGA i at gøre nye funktionelle opdagelser. Ud ov…
Divulgations
The authors have nothing to disclose.
Acknowledgements
Dette arbejde blev støttet af midler fra Genome Canada, Ontario Genomics Institute, og den canadiske Institutes of Health Research tilskud til JG og AE AG er en modtager af Vanier Canada Graduate Scholarship.
Materials
| I. Antibiotics | 2 | 36471 Remove |
||||
| Chloramphenicol | Bioshop | #CLR201 | 3 | 36472 Remove |
||
| Kanamycin | #KAN201 | 4 | 36480 Remove |
|||
| Ampicillin | # AMP201 | 5 | 36473 Remove |
|||
| 2. Luria-Bertani medium | 6 | 36474 Remove |
||||
| LB powder | Bioshop | #LBL405 | 7 | 36478 Remove |
||
| Agar | Bioshop | #AGR003 | 8 | 36481 Remove |
||
| 3. Bacterial Strains and Plasmids | 9 | 36475 Remove |
||||
| Hfr Cavalli strain λred system (JL238) | Babu et al.14. | 10 | 36476 Remove |
|||
| pKD3 | E. coli Genetic Stock Centre, Yale | 11 | 36477 Remove |
|||
| Keio E. coli F- recipient collection | National BioResource Project (NBRP) of Japan11 | 12 | 36479 Remove |
|||
| Hypomorphic E. coli F- SPA-tag strains | Open biosystems; Babu et al.14 | 13 | 36491 Remove |
|||
| 4. Primers | 14 | 36486 Remove |
||||
| pKD3-based desalted constant primers | F1: 5′-GGCTGACATGGGAATTAGC-3′ R1: 5′-AGATTGCAGCATTACACGTCTT-3′ |
15 | 36482 Remove |
|||
| Desalted custom primers | Cm-R: 5′-TTATACGCAAGGCGACAAGG-3′ Cm-F: 5′- GATCTTCCGTCACAGGTAGG-3′ |
16 | 36483 Remove |
|||
| Desalted custom primers | F2 and R2: 20 nt constant regions based on pKD3 sequence and 45 nt custom homology regions F2 constant region: 5′-CATATGAATATCCTCCTTA-3′ R2 constant region: 5′-TGTGTAGGCTGGAGCTGCTTC-3’S1 and S2: 27 nt constant regions for priming the amplification of the SPA-Cm cassette and 45 nt custom homology regions S1 constant region: 5’AGCTGGAGGATCCATGGAAAAGAGAAG -3′ S2 constant region: 5′- GGCCCCATATGAATATCCTCCTTAGTT -3′ KOCO-F and KOCO-C: 20 nt primers 200 bp away from the non-essential gene deletion site or the essential gene SPA-tag insertion site |
17 | 36484 Remove |
|||
| 5. PCR and Electrophoresis Reagents | 18 | 36485 Remove |
||||
| Taq DNA polymerase | Fermentas | # EP0281 | 19 | 36487 Remove |
||
| 10X PCR buffer | Fermentas | # EP0281 | 20 | 36488 Remove |
||
| 10 mM dNTPs | Fermentas | # EP0281 | 21 | 36489 Remove |
||
| 25 mM MgCl2 | Fermentas | # EP0281 | 22 | 36490 Remove |
||
| Agarose | Bioshop | # AGA002 | 23 | 36492 Remove |
||
| Loading dye | NEB | #B7021S | 24 | 36493 Remove |
||
| Ethidium bromide | Bioshop | # ETB444 | 25 | 36497 Remove |
||
| 10X TBE buffer | Bioshop | # ETB444.10 | 26 | 36494 Remove |
||
| Tris Base | Bioshop | # TRS001 | 27 | 36495 Remove |
||
| Boric acid | Sigma | # T1503-1KG | 28 | 36496 Remove |
||
| 0.5 M EDTA (pH 8.0) | Sigma | # B6768-500G | 29 | 36498 Remove |
||
| DNA ladder | NEB | #N3232L | 30 | 36499 Remove |
||
| 6. DNA isolation and Clean-up Kits | 31 | 36500 Remove |
||||
| Genomic DNA isolation and purification kit | Promega | #A1120 | 32 | 36501 Remove |
||
| Plasmid Midi kit | Qiagen | # 12143 | 33 | 36502 Remove |
||
| QIAquick PCR purification kit | Qiagen | #28104 | 34 | 36512 Remove |
||
| 7. Equipment for PCR, Transformation and Replica-pinning | 35 | 36503 Remove |
||||
| Thermal cycler | BioRad, iCycler | 36 | 36504 Remove |
|||
| Agarose gel electrophoresis | BioRad | 37 | 36505 Remove |
|||
| Electroporator | Bio-Rad GenePulser II | 38 | 36506 Remove |
|||
| 0.2 cm electroporation cuvette | Bio-Rad | 39 | 36507 Remove |
|||
| 42 °C water bath shaker | Innova 3100 | 40 | 36508 Remove |
|||
| Beckman Coulter TJ-25 centrifuge | Beckman Coulter | 41 | 36519 Remove |
|||
| 32 °C shaker | New Brunswick Scientific, USA | 42 | 36509 Remove |
|||
| 32 °C plate incubator | Fisher Scientific | 43 | 36510 Remove |
|||
| RoToR-HDA benchtop robot | Singer Instruments | 44 | 36511 Remove |
|||
| 96, 384 and 1,536 pin density pads | Singer Instruments | 45 | 36513 Remove |
|||
| 96 or 384 long pins | Singer Instruments | 46 | 36514 Remove |
|||
| 8. Imaging Equipments | 47 | 36515 Remove |
||||
| Camera stand | Kaiser | 48 | 36516 Remove |
|||
| Digital camera, 10 megapixel | Any Vendor | 49 | 36517 Remove |
|||
| Light boxes, Testrite 16″ x 24″ units | Testrite | 50 | 36527 Remove |
|||
| 9. Pads or Plates Recycling | 51 | 36518 Remove |
||||
| 10% bleach | Any Vendor | 52 | 36520 Remove |
|||
| 70% ethanol | Any Vendor | 53 | 36521 Remove |
|||
| Sterile distilled water | Any Vendor | 54 | 36522 Remove |
|||
| Flow hood | Any Vendor | 55 | 36523 Remove |
|||
| Ultraviolet lamp | Any Vendor | 56 | 36524 Remove |
|||
| 10. Labware | 57 | 36525 Remove |
||||
| 50 ml polypropylene tubes | Any Vendor | 58 | 36526 Remove |
|||
| 1.5 ml micro-centrifuge tubes | Any Vendor | 59 | 36528 Remove |
|||
| 250 ml conical flaks | VWR | # 29140-045 | 60 | 36529 Remove |
||
| 15 ml sterile culture tubes | Thermo Scientific | # 366052 | 61 | 36530 Remove |
||
| Cryogenic vials | VWR | # 479-3221 | 62 | 36531 Remove |
||
| Rectangular Plates | Singer Instruments | 63 | 36532 Remove |
|||
| 96-well and 384-well microtitre plates | Singer Instruments | Nunc | 64 | 36533 Remove |
||
| Plate roller for sealing multi-well | Sigma | #R1275 | 65 | 36535 Remove |
||
| plates | ABgene | # AB-0580 | 66 | 36534 Remove |
||
| Adhesive plate seals | Fisher Scientific | # 13-990-14 | 67 | 36537 Remove |
||
| -80 °C freezer | Any Vendor | 68 | 36536 Remove |
References
- Bandyopadhyay, S., Kelley, R., Krogan, N. J., Ideker, T. Functional maps of protein complexes from quantitative genetic interaction data. PLoS Comput. Biol. 4, e1000065 (2008).
- Costanzo, M., Baryshnikova, A., Myers, C. L., Andrews, B., Boone, C. Charting the genetic interaction map of a cell. Curr. Opin. Biotechnol. 22, 66-74 (2011).
- Costanzo, M., et al. The genetic landscape of a cell. Science. 327, 425-4231 (2010).
- Fiedler, D., et al. Functional organization of the S. cerevisiae phosphorylation network. Cell. 136, 952-963 (2009).
- Roguev, A., et al. Conservation and rewiring of functional modules revealed by an epistasis map in fission yeast. Science. 322, 405-4010 (2008).
- Schuldiner, M., et al. Exploration of the function and organization of the yeast early secretory pathway through an epistatic miniarray profile. Cell. 123, 507-519 (2005).
- Wilmes, G. M., et al. A genetic interaction map of RNA-processing factors reveals links between Sem1/Dss1-containing complexes and mRNA export and splicing. Mol. Cell. 32, 735-746 (2008).
- Babu, M., et al. Systems-level approaches for identifying and analyzing genetic interaction networks in Escherichia coli and extensions to other prokaryotes. Mol. Biosyst. 12, 1439-1455 (2009).
- Butland, G., et al. coli synthetic genetic array analysis. Nat. Methods. 5, 789-7895 (2008).
- Typas, A., et al. Regulation of peptidoglycan synthesis by outer-membrane proteins. Cell. 143, 1097-10109 (2010).
- Baba, T., et al. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2, 2006-200008 (2006).
- Babu, M., et al. Genetic interaction maps in Escherichia coli reveal functional crosstalk among cell envelope biogenesis pathways. PLoS Genet. 7, e1002377 (2011).
- Nichols, R. J., et al. Phenotypic landscape of a bacterial cell. Cell. 144, 143-156 (2011).
- Babu, M., Gagarinova, A., Greenblatt, J., Emili, A. Array-based synthetic genetic screens to map bacterial pathways and functional networks in Escherichia coli. Methods Mol Biol. 765, 125-153 (2011).
- Datsenko, K. A., Wanner, B. L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 97, 6640-665 (2000).
- Yu, D., et al. An efficient recombination system for chromosome engineering in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 97, 5978-5983 (2000).
- Typas, A., et al. quantitative analyses of genetic interactions in. E. coli. Nat. Methods. 5, 781-787 (2008).
- Zeghouf, M., et al. Sequential Peptide Affinity (SPA) system for the identification of mammalian and bacterial protein complexes. J. Proteome Res. 3, 463-468 (2004).
- Davierwala, A. P., et al. . , 1147-1152 (2005).
- Breslow, D. K., et al. A comprehensive strategy enabling high-resolution functional analysis of the yeast genome. Nat. Methods. 5, 711-718 (2008).
- Babu, M., et al. Sequential peptide affinity purification system for the systematic isolation and identification of protein complexes from Escherichia coli. Methods Mol. Biol. 564, 373-400 (2009).
- Butland, G., et al. Interaction network containing conserved and essential protein complexes in Escherichia coli. Nature. 433, 531-537 (2005).
- Hu, P., Janga, S. C., Babu, M., Diaz-Mejia, J. J., Butland, G., et al. Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7, (2009).
- Anderson, R. P., Roth, J. R. Tandem genetic duplications in phage and bacteria. Annu. Rev. Microbiol. 31, 473-505 (1977).
- Boone, C., Bussey, H., Andrews, B. J. Exploring genetic interactions and networks with yeast. Nat. Rev. Genet. 8, 437-449 (2007).
- Collins, S. R., et al. Functional dissection of protein complexes involved in yeast chromosome biology using a genetic interaction map. Nature. 446, 806-8010 (2007).
- Le Meur, N., Gentleman, R. Modeling synthetic lethality. Genome Biol. 9, R135 (2008).
- Tong, A. H., et al. Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science. 294, 2364-2368 (2001).
- Tong, A. H., et al. Global mapping of the yeast genetic interaction network. Science. 303, 808-813 (2004).
- Wong, S. L., et al. Combining biological networks to predict genetic interactions. Proc. Natl. Acad. Sci. U.S.A. 101, 15682-15687 (2004).
- van Opijnen, T., Bodi, K. L., Camilli, A. Tn-seq: high-throughput parallel sequencing for fitness and genetic interaction studies in microorganisms. Nat. Methods. 6, 767-772 (2009).
- Gagarinova, A., Emili, A. Genome-scale genetic manipulation methods for exploring bacterial molecular biology. Mol. Biosyst. 8, 1626-1638 (2012).
- Dewey, C. N., et al. Positional orthology: putting genomic evolutionary relationships into context. Brief Bioinform. 12, 401-412 (2011).
- St Onge, R. P., et al. Systematic pathway analysis using high-resolution fitness profiling of combinatorial gene deletions. Nat. Genet. 39, 199-206 (2007).
