Protein-protein interactions are visualized in cells with nanometer spatial resolution by combining bimolecular fluorescence complementation (BiFC) with photoactivated localization microscopy (PALM). Described here is the use of BiFC-PALM for imaging Ras-Raf interactions in U2OS cells for visualizing the nanoscale clustering and diffusion of individual Ras-Raf complexes.
Protein-protein interactions (PPIs) are key molecular events to biology. However, it remains a challenge to visualize PPIs with sufficient resolution and sensitivity in cells because the resolution of conventional light microscopy is diffraction-limited to ~250 nm. By combining bimolecular fluorescence complementation (BiFC) with photoactivated localization microscopy (PALM), PPIs can be visualized in cells with single molecule sensitivity and nanometer spatial resolution. BiFC is a commonly used technique for visualizing PPIs with fluorescence contrast, which involves splitting of a fluorescent protein into two non-fluorescent fragments. PALM is a recent superresolution microscopy technique for imaging biological samples at the nanometer and single molecule scales, which uses phototransformable fluorescent probes such as photoactivatable fluorescent proteins (PA-FPs). BiFC-PALM was demonstrated by splitting PAmCherry1, a PA-FP compatible with PALM, for its monomeric nature, good single molecule brightness, high contrast ratio, and utility for stoichiometry measurements. When split between amino acids 159 and 160, PAmCherry1 can be made into a BiFC probe that reconstitutes efficiently at 37 °C with high specificity to PPIs and low non-specific reconstitution. Ras-Raf interaction is used as an example to show how BiFC-PALM helps to probe interactions at the nanometer scale and with single molecule resolution. Their diffusion can also be tracked in live cells using single molecule tracking (smt-) PALM. In this protocol, factors to consider when designing the fusion proteins for BiFC-PALM are discussed, sample preparation, image acquisition, and data analysis steps are explained, and a few exemplary results are showcased. Providing high spatial resolution, specificity, and sensitivity, BiFC-PALM is a useful tool for studying PPIs in intact biological samples.
Protein-protein interactions (PPIs) are fundamental to biology1 and are tightly regulated via spatiotemporal mechanisms across many time and length scales. Studies on cell signaling on the cell membrane, for example, have revealed dynamic, nanoscale spatial compartments that facilitate specific PPIs and cellular processes2. Hence, the ability to probe PPIs in biological systems with sufficient spatial and temporal resolutions, high specificity, and high sensitivity is key to achieving a mechanistic understanding of biology.
Bimolecular fluorescence complementation (BiFC) is one of the few existing tools for visualizing PPIs in a cell with subcellular resolution and live-cell compatibility3–5. The technique is relatively straightforward and involves splitting of a fluorescence protein into two non-fluorescent fragments; when genetically tagged to two interacting proteins and brought into proximity, the fragments can reconstitute to form a complete fluorescent protein, yielding fluorescent signal. When properly designed, BiFC probes should not spontaneously reconstitute in the absence of PPIs. As such, the fluorescence signal in a BiFC assay will only arise in the presence of PPIs, which enables direct visualization of PPIs with high specificity. Additional benefits of using fluorescence as the readout are high sensitivity, subcellular resolution, and compatibility with high throughput and high content screening assays, among others. For these benefits, a number of BiFC probes based on different parent fluorescent proteins have been developed. As in all other detection techniques based on conventional light microscopy, however, the spatial resolution of BiFC is limited to ~250 nm by the diffraction of light. This makes it a challenge to study the regulation of PPIs at the nanoscale, which, as alluded earlier and exemplified by lipid rafts6 and Ras nanoclusters7, is a critical length scale to understanding many cellular processes such as signaling.
BiFC has been combined with photoactivated localization microscopy (PALM)8,9 to overcome this limit in spatial resolution for imaging PPIs10. PALM is a recent superresolution microscopy technique that circumvents the diffraction limit in fluorescence imaging through stochastic activation and subdiffractive localization of single fluorescent molecules. In each activation cycle, a fluorescent molecule emits a few hundred to a few thousand photons and gives rise to a single molecule image on the detector. While the image is diffraction-limited (~250 nm in width), its centroid can be determined with much higher precision, typically on the order of 10-50 nm depending on the number of photons detected. By activating and localizing each fluorescent molecule in the sample, a high resolution image can be reconstructed. Performed on living cells, single molecule tracking (smt-) PALM further permits acquisition of thousands of protein diffusion trajectories from a single cell11. Importantly, PALM uses specialized fluorescent probes such as photoactivatable fluorescent proteins (PA-FPs) to achieve stochastic activation. Since both BiFC and PALM use fluorescent proteins, they were combined by splitting PAmCherry1, a commonly used PA-FP for PALM, into two fragments between amino acids 159 and 160.
The BiFC system based on split PAmCherry1 shows low background signal from spontaneous reconstitution of the two fragments. When genetically tagged to a pair of interacting proteins, the two fragments (RN = residues 1-159; RC = Met + residues 160-236) reconstituted efficiently to form complete PAmCherry1 proteins even at 37 °C and without incubating at lower temperatures, which is not the case for other BiFC pairs12 such as the parent mCherry13. Furthermore, the reconstituted PAmCherry1 protein retained the photophysical properties of the parent PAmCherry1, such as high contrast ratio, medium photon yield, and fast photoactivation, among others, which are critical for accurate single molecule localization and high-resolution PALM imaging.
In this protocol, the use of BiFC-PALM for imaging Ras-Raf interactions in U2OS cells by using split PAmCherry1 (Figure 1A) is described. The first step is to design the constructs for expressing fusion proteins between PAmCherry1 fragments (i.e., RN and RC) and the proteins of interest. In theory, for each pair of candidate proteins (A and B), there are eight pairs of fusion proteins to be tested: RN-A/RC-B; RN-A/B-RC; RC-A/RN-B; RC-A/B-RN; A-RN/RC-B; A-RN/B-RC; A-RC/RN-B; and A-RC/B-RN. This process can often be simplified by taking into account the structural or biochemical properties of the candidate proteins. In the case of Ras, the protein is post-translationally modified at the C-terminal CAAX box (C=Cys; A=aliphatic; X=any), after which the AAX motif is cleaved off. Hence, RN or RC can only be fused to the N-terminus of Ras; this reduces the number of fusion protein pairs to four (Figure 1B). For Raf, the Ras-binding domain (RBD; residues 51-131) is used and can be tagged on either end. These four fusion configurations were generated: RN-KRas/RC-Raf RBD; RN-KRas/Raf RBD-RC; RC-KRas/RN-Raf RBD; and RC-KRas/Raf RBD-RN.
Additionally, the linker between the fragments and the proteins of interest will need to be considered. A flexible linker of about ten amino acids is often used as it provides sufficient freedom for complementation to occur. One such linker is (GGGGS)x2, although there are many others that have been successfully applied, including random sequences generated from a multiple cloning site (MCS)14. The length of the linkers may need to be optimized depending on the size of the proteins of interest and their orientations when interacting.
The PAmCherry1 fragments are contained in a small cloning backbone with flanking MCSs (see Materials List). Genes of interest can be inserted via the restriction sites or with a ligation-independent method. After cloning and sequence verification, the expression cassette is transferred to an expression vector using a recombinase reaction, a cloning process with high fidelity and high efficiency.
Next, the resulting expression constructs are transfected into the target cell line or, if a stable cell line is desired, packaged into lentivirus for infecting the target cell line. Transient transfection allows for quick validation of the BiFC configurations, but potential problems must be noted. Transfection using chemicals often stresses the cells, resulting in high autofluorescence; while the use of total internal reflection fluorescence (TIRF) microscopy can mitigate this background signal by limiting the illumination volume, TIRF ideal when the PPIs take place on the cell membrane. Additionally, transient transfections often lead to high levels of protein expression, far exceeding those of the endogenous proteins, which may cause artifacts in detecting the PPIs. Hence, it is recommended that stable cell lines be established after an appropriate BiFC configuration has been determined through initial testing. Stable cell lines also have the potential for tunable expression via doxycycline induction15.
After infection, cells are selected with antibiotics, typically puromycin and neomycin, one for each construct. The subsequent steps for sample preparation, image acquisition, and data analysis will be described in detail in the protocols.
With this approach, the formation of nanoscale clusters in BiFC-PALM images of Ras-Raf RBD are routinely observed (Figure 2A). Consistently, smt-PALM trajectories of Ras-Raf RBD show a heterogeneous distribution in the diffusion states (Figure 2B-D). These results suggest that Ras-Raf complexes exist in multiple states on the cell membrane, presumably as monomers and clusters, with potential biological implications. This work demonstrates the power of BiFC-PALM in selective imaging of PPIs in cells with nanometer spatial resolution and single molecule sensitivity, which would be difficult to obtain with conventional BiFC, fluorescence co-localization, or fluorescence resonance energy transfer (FRET).
When designing BiFC experiments and interpreting the results, it is important to keep in mind that the BiFC process is irreversible in most cases, including split PAmCherry1. Once the two fragments combine and form a complete PAmCherry1 protein, the linkage between the two fragments, and thus the PPI becomes permanent. This limits the use of BiFC and BiFC-PALM for monitoring the dynamics of the PPIs (i.e., binding kinetics and not the diffusion dynamics of the protein complex once it is formed) and at times could even lead to mislocalization of the PPI complexes.
An additional factor to consider when designing BiFC-PALM experiments is the delay in chromophore maturation that is inherent in fluorescent proteins. Once two proteins interact and the FP fragments come together, they typically refold on the order of seconds (half-time of 60 sec for EYFP3). However, subsequent chromophore maturation and fluorescent signal develop on the order of minutes. While fluorescence may be detectable within 10 min after reconstitution of split-Venus, a fast-folding YFP variant, the half-time for maturation in general is often around 60 min16. Split-PAmCherry1 was observed to have similar rates. Hence, BiFC and BiFC-PALM are currently poor choices for monitoring real-time PPI kinetics; other methods, such as FRET and a recently developed dimerization dependent fluorescent protein17, may be more suited for this purpose.
1. Cloning
2. Imaging Fixed Cells
3. Single Molecule Tracking in Live Cells
The BiFC-PALM example shown is KRas G12D mutant interacting with the Ras binding domain (RBD) of CRaf (Figure 1A). As discussed, the RN or RC fragments were not tagged to the C-terminus of Ras because it would disrupt the membrane localization and hence the biological activity of Ras. This reduced the possible combinations from eight to four (Figure 1B). Each of these four combinations was introduced into U2OS cells using lentiviral infection. The cells were fixed as detailed in the protocol, and the BiFC signals were evaluated using a PALM setup. Cells with positive BiFC signals were identified by the abrupt increase in fluorescence when the 405 nm laser was turned on; the 561 nm laser was on throughout the imaging experiment. This abrupt change in fluorescence is due to the photoactivation of BiFC-reconstituted PAmCherry1 upon illumination with the 405 nm laser. Multiple regions in the sample were evaluated using this approach, and the BiFC signal intensity was calculated by averaging the increase in pixel intensities before and after a high-powered pulse from the 405 nm laser.
As seen in Figure 1C, out of the four possible configurations, two configurations (namely RN-Ras/RC-Raf RBD and RN-Ras/Raf RBD-RC) had strong BiFC signals. Another configuration (RC-Ras/Raf RBD-RN) had weak signal, and one had no signal. For all subsequent experiments, the RN-Ras/Raf RBD-RC configuration (upper right in Figure 1C) was used. As a negative control, a point mutation (R89L) in the Ras binding domain of Raf was introduced and the BiFC efficiency using the same configuration was tested. This mutation was known to disrupt Raf binding to Ras; consistently, the mutation greatly reduced the BiFC signal (Figure 1D).
Since PAmCherry1 molecules generated through BiFC showed similar photoactivation properties to the original PAmCherry110, this allows for PALM imaging of BiFC samples using the same experimental settings as with the parent PAmCherry1. An example PALM image of cells with strong BiFC signal after infection with RN-Ras and Raf RBD-RC is shown in Figure 2A.
When zoomed in (Figure 2A bottom left and insets, with magnified areas boxed), individual molecules and their nanoscale spatial distribution can be clearly seen. Of note, each dot in these PALM images represents one putative Ras-Raf RBD complex tagged with a PAmCherry1 molecule. For comparison, the right side of Figure 2B was simulated low resolution images of the same fields of view, where the clusters became completely obscure. The observation of Ras-Raf RBD clusters is consistent with previous observations on the clustering behavior of Ras and Raf.
With live cells expressing BiFC reconstituted PAmCherry1, smt-PALM was performed to acquire diffusion trajectories of individual Ras-Raf RBD complexes, similarly to previously described10. Under continuous illumination with 561 nm and 405 nm lasers, individual PAmCherry1 molecules stochastically switch on and last a few frames before entering dark states (in part due to photobleaching). In this period of time, the molecules exhibited at least two different diffusion behaviors: an immobile state (Figure 2B, molecule 1) and a mobile state (Figure 2B, molecule 2). Both types of trajectories are clearly present in the (x, y) plot shown in Figure 2C, where the trajectories of multiple molecules are recorded. The same heterogeneous distribution of diffusion states can be inferred from the histogram of molecular displacement between successive frames. Typically, 10,000 – 100,000 diffusion trajectories can be acquired from each cell; this large number allows for more rigorous statistical analysis of the diffusion states, for example with the vbSPT algorithm25.
Figure 1. BiFC-PALM experimental design of Ras-Raf interaction. (A) Ras is a membrane bound protein that recruits Raf when active. When non-fluorescent split PAmCherry1 fragments are attached to Ras and Raf, the interaction brings the fragments together and complementation occurs, resulting in a functional fluorescent protein. (B) Since tagging Ras at its C-terminus would disrupt its membrane localization, the number of configurations tested for Ras-Raf BiFC-PALM was reduced from eight to four. (C) Images of U2OS cells expressing the tested configurations taken with a TIRF microscope. To gauge the BiFC efficiency of each configuration, cells are given the same high dosage of 405 nm light while being excited with 561 nm light. (D) Introducing the R89L mutation into the Raf RBD greatly reduced the BiFC signal of the RN-KRas G12D/CRaf RBD-RC configuration (upper right in C, n = 5-8). Error bars are SEM in (D). Scale bars in (C), 10 µm. RN = PAmCherry1 N-terminal fragment, RC = PAmCherry1 C-terminal fragment, and RBD = Ras binding domain. Please click here to view a larger version of this figure.
Figure 2. BiFC-PALM of U2OS cells expressing the RN-KRas G12D/CRaf RBD-RC configuration. (A) An entire PALM image is shown above. Lower panels are magnified views of the boxed regions in the upper image as indicated. Insets are higher magnifications of the boxed regions in the respective magnified views. The right side of the lower panels (labeled TIRF) are representations of the images on their left as though taken with a diffraction-limited microscope. (B) Successive frames from a live cell smt-PALM experiment that depict slow (1) and fast (2) moving Ras-Raf complexes. (C) Output from a smt-PALM experiment showing diffusion trajectories of Ras-Raf complexes within a small area of a cell. (D) Histogram of displacements per frame of Ras-Raf complexes from a smt-PALM experiment. Scale bars in (A), 5 µm top, 500 nm bottom, 50 nm insets, and (C), 1 µm. RN = PAmCherry1 N-terminal fragment, RC = PAmCherry1 C-terminal fragment, and RBD = Ras binding domain. Please click here to view a larger version of this figure.
Primer sequence (5’ to 3’) | |
Cloning plasmid for insertion at N-terminus reverse | CATGGTACCGAGCTCCTGCAGC |
RN at N-terminus forward | GTGAGCAAGGGCGAGGAGGATAA |
RC at N-terminus forward | GGCGCCCTGAAGGGCGA |
Cloning plasmid for insertion at C-terminus forward | TAAAAGGGTGGGCGCGCC |
RN from C-terminus reverse | GTCCTCGGGGTACATCCGCTC |
RC from C-terminus reverse | CTTGTACAGCTCGTCCATGCCG |
Table 1. Primers for linearizing cloning plasmids containing PAmCherry1 fragments. The cloning plasmids containing RN and RC can be linearized with inverse PCR at the point of insertion at either the N- or C-terminus of the fragments. Sequences are listed 5’ to 3’.
Overhangs for gene of interest primers (5' to 3') | |
N-terminal insertion RN or RC forward | GAGCTCGGTACCATG |
N-terminal insertion RN reverse | ACTTCCACCTCCACCACTACCTCCACCTCCCTCGCCCTTGCTCAC |
N-terminal insertion RC reverse | ACTTCCACCTCCACCACTACCTCCACCTCCGCCCTTCAGGGCGCC |
C-terminal insertion RN forward | ATGTACCCCGAGGACGGAGGTGGAGGTAGTGGTGGAGGTGGAAGT |
C-terminal insertion RC forward | GACGAGCTGTACAAGGGAGGTGGAGGTAGTGGTGGAGGTGGAAGT |
C-terminal insertion RN or RC reverse | GCGCCCACCCTTTTA |
Table 2. Overhangs for gene of interest primers that match Table 1 primers. The 15 base pairs of homology for the ligation-independent reaction is generated from primer overhangs. Additionally, the overhangs include the sequence for a (GGGGS)x2 flexible linker. The flexible linker sequence can be added to the primers in Table 1 instead. Sequences are listed 5’ to 3’.
BiFC has been a commonly used technique for detecting and visualizing PPIs in cells, while PALM is a recent single molecule superresolution microscopy technique that enables nanoscale imaging of intact biological samples. The combination of BiFC with PALM achieved selective imaging of PPIs inside a cell with nanometer spatial resolution and single molecule sensitivity. BiFC-PALM extends the utility of both techniques, and as demonstrated in this work, shows great promise in revealing the molecular details of PPIs in their native cellular context. In particular, the nanometer resolution allows for detailed investigation of the spatial and temporal regulation of specific PPIs at the molecular scale, which has been a challenge in biomedical research. However, as mentioned before, BiFC-PALM is limited by the irreversibility of the complementation and slow chromophore maturation.
Split PAmCherry1 was used to demonstrate the principle and utility of BiFC-PALM. PAmCherry1 has been widely used in PALM experiments for its excellent photophysical properties. An additional benefit of using PAmCherry1 as the BiFC probe is the low background and high specificity and efficiency in protein reconstitution at 37 °C when coupled to PPIs. For these reasons, the split PAmCherry1 BiFC probe is expected to become a valuable resource applicable to many different biological investigations involving high resolution imaging of PPIs. In addition to PAmCherry1, a photoconvertible fluorescent protein, mEos3.2, was also split for BiFC-PALM26. Because their emission spectrums overlap, mEos3.2 and PAmCherry1 cannot be used together, but green PA-FPs have recently been reported27, opening the possibility for two-color nanoscale superresolution imaging of PPIs.
As in conventional BiFC, a critical step in implementing BiFC-PALM is the design and cloning of the fusion constructs. The fact that up to eight different expression constructs have to be cloned and eight BiFC pairs have to be tested in each attempt to implement BiFC and BiFC-PALM can be a tedious, if not prohibitive, process. Nevertheless, as illustrated in the Ras-Raf example, prior knowledge on the biochemical and structural properties of the proteins of interest often can be used to guide an optimized design of the fusion constructs with a reduced number of BiFC pairs to be tested. That said, currently there is not a universal guideline to ensure that a BiFC (hence BiFC-PALM) experiment would work; much of it is still an art.
While BiFC and BiFC-PALM are typically used to investigate heterodimer formation between two proteins, it is also feasible to study homodimer formation using these approaches, in which case the two candidate proteins would be the same. However, as such, two proteins with the same fragment can interact but not result in BiFC signal. Despite each construct acting as a competitive inhibitor to the other, such interactions are reversible, while interactions resulting in successful complementation would accumulate due to the irreversibility. In general, there could be a reduction in signal if there is a drastic difference between expression levels of each construct. Therefore, the expression levels of the two constructs may need to be determined when comparing fluorescence intensities (e.g., between wild type and mutant homodimer samples) at endogenous expression levels. This is perhaps why BiFC experiments are commonly performed with transient transfections and overexpression of the constructs.
Last but not least, all BiFC experiments must be confirmed with proper controls. If BiFC signal is present, there is a chance that the signal is non-specific (i.e., the fragments are reconstituting on their own and not because of the PPI). One negative control is mutations in either or both proteins that are known to disrupt the interaction, which should result in a significant loss of BiFC signal. If such a point mutation is unknown, other methods can be used, such as introducing a competitive binding partner to one of the proteins and see if there is a concomitant decrease in signal.
The more difficult situation is troubleshooting a lack of BiFC signal, or false negatives. In such cases, it is important to include positive controls during the cloning process, such as a GFP control during transfections. Western blots can be run to check for expression of the constructs. If these factors are normal, other factors may need to be changed, such as the linker length and/or sequence, or a different BiFC configuration should be considered.
As for the PALM portion, a number of parameters must be considered when processing the images. Step 2.4.2.1 describes parameters used for sorting the coordinates and generating the final PALM image. The first two parameters, Combining Frame and Combining Distance, define if two localization events are both within 100 nm and appear less than 8 frames (at 100 msec/frame) or ~0.8 sec apart as we described previously23. If so, then they will be considered to arise from the same molecule, and their coordinates will be combined by averaging. Dark states with lifetimes much greater than 0.8 sec for PAmCherry1 appears to be rare; as the event of a fluorophore recovering from a long-lived dark state is indistinguishable from a different molecule at a proximal distance emitting fluorescence, two localization events are considered to be arising from the same molecule only if they appeared within a certain number of frames and physical distance. Empirically, a ‘combine frame’ setting at 8-12 frames (0.8-1.2 sec) appears to be optimal under our experimental conditions. Minimum RMS defines the minimal ratio between fitting amplitude and the standard deviation of residue noise after the fitting. These values are recorded in the .cor file during coordinate extraction.
In summary, BiFC-PALM combines the advantages of BiFC and PALM and enables investigation of PPIs at much greater detail than what has been achieved previously. With considerations for the factors above and with proper control experiments, BiFC-PALM should be a useful tool for studying PPIs in a broad range of biological settings.
The authors have nothing to disclose.
The authors thank Drs. Steven Chu and Joe W. Gray for helpful discussions, Henry Marr for his initial work on the BiFC-PALM project, and Alexis Shoemaker for her technical assistance. This work is supported by startup funds to X.N. from OHSU. Research in the Nan laboratory was also supported by NIH 5U54CA143836-05, the Damon Runyon Cancer Research Foundation, the M. J. Murdock Charitable Trust, and the FEI company.
TIRF Microscope | Nikon | ||
60X oil immersion TIRF objective with 1.49 NA | Nikon | ||
EMCCD camera | Andor | iXon Ultra 897 | |
561 nm laser | Coherent | ||
405 nm laser | Coherent | ||
561 nm dichroic mirror | Semrock | Di01-R405/488/561/635-25×36 | |
561 nm filter | Semrock | FF01-525/45-25 | |
405/561 nm notch filter | Semrock | NF01-405/488/568-25 | |
Temperature and CO2 controlled stage | |||
pENTR-D-TOPO-PAmCherry1_1-159-MCS | Addgene | 60545 | |
pENTR-D-TOPO-PAmCherry160-236-MCS | Addgene | 60546 | |
pcDNA3.2-DEST | Life Technologies | 12489-019 | |
pLenti-DEST | Addgene | http://www.addgene.org/Eric_Campeau/ | |
Phusion High-Fidelity DNA Polymerase | Thermo Scientific | F-531 | |
In-Fusion HD Cloning | Clontech | 639649 | |
LR Clonase | Life Technologies | 11791 | |
Vira Power Lentivirus Packaging | Life Technologies | K497500 | |
X-tremeGENE Transfection Reagent | Roche | 13873800 | |
Lab-Tek II Chambered Coverglass | Thermo Scientific | 155409 | #1.5 glass bottom dishes |
U2OS cells | ATCC | HTB-96 | |
293T/17 cells | ATCC | CRL-11268 | |
DMEM with phenol red | Life Technologies | 11995 | |
DMEM no phenol red | Life Technologies | 21063 | |
Fetal bovine serum | Life Technologies | 10082 | |
Leibovit's L-15, no phenol red | Life Technologies | 21083-027 | |
Reduced serum medium | Life Technologies | 31985 | |
Phosphate Buffered Saline | Life Technologies | 14040 | |
Syringe | BD Biosciences | 309604 | |
Syringe filter | Millipore | SLHV033RB | |
Lentiviral concentrator | Clontech | 631231 | |
Retroviral concentrator | Clontech | 631455 | |
10 cm culture dish | BD Biosciences | 353003 | |
6-well culture plate | BD Biosciences | 353046 | |
Polybrene | Sigma | 107689 | |
Puromycin | Life Technologies | A11138 | |
G-418 | Calbiochem | 345812 | Neomycin |
Doxycyline | Fisher | BP2653 | |
Tris base | Fisher | BP152 | |
EDTA | Sigma | EDS | |
Sodium Hydroxide | Sigma | S5881 | |
Paraformaldehyde | Sigma | 158127 | |
Glutaraldehyde | Sigma | G6257 | |
PIPES | Sigma | P6757 | |
HEPES | Sigma | H4034 | |
EGTA | Sigma | 3777 | |
Magnesium Sulfate | Sigma | M2643 | |
Potassium Hydroxide | Sigma | 221473 | |
Sodium chloride | Fisher | BP358 | |
Magnesium chloride | Fisher | M33 | |
100 nm gold particles | BBI Solutions | EM.GC100 | |
Molecular grade water | Life Technologies | 10977 | |
Dpn1 | New England Biolabs | R0176 | |
PCR purification kit | Qiagen | 28104 | |
Miniprep kit | Qiagen | 27104 | |
Midiprep kit | Macherey-Nagel | 740410 | |
0.6 mL microcentrifuge tubes | Fisher | 05-408-120 | |
1.5 mL microcentrifuge tubes | Fisher | 05-408-137 | |
15 mL tubes | Fisher | 05-539-12 | |
5 mL polypropylene round-bottom tubes | BD Biosciences | 352063 | |
14 mL polypropylene round-bottom tubes | BD Biosciences | 352059 | |
50 mL tube | BD Biosciences | 352070 | |
PCR tube | GeneMate | C-3328-1 | |
SOC medium | Life Technologies | 15544 | |
LB broth | BD Biosciences | 244610 | |
Kanamycin sulfate | Fisher | BP906 | |
Competent cells | Life Technologies | C4040 | |
Matlab | Mathworks |