인간 배아 줄기 세포로부터 생성 된 내배엽 세포의 정제를위한 신속하고 효율적인 방법
Summary
여기서는 하류 어플리케이션 및 상기 분화의 개선을위한 결정적인 내배엽으로 분화 노력하고 인간 배아 줄기 세포의 정제를위한 방법을 설명한다.
Abstract
배아 줄기 세포 (는 ESC)와 같은 다 능성 줄기 세포의 분화 능력은 세포 대체 요법에 대한 잠재적 인 치료 적 적용을 허용한다. 말단 분화 세포 유형. 각종 퇴행성 질환의 치료에 사용되는 폐, 간 및 췌장 조직을 향해 이러한 세포의 체외 분화는 첫 단계로 최종 내배엽 세포의 생성을 필요로 할 수있다. 이 단계는 속도 제한 인슐린 – 생산 베타 세포, 간세포 등 내배엽 유래의 세포 유형으로 말단 성숙 세포 유형 향해 더 분화된다. 내배엽 계통을 향해 최선을 다하고 있습니다 세포는 매우 같은 FOXA2, SOX17, HNF1B, GATA 가족의 구성원, 표면 수용체 CXCR4 같은 전사 인자의 군중을 표현한다. 그러나, 분화 프로토콜은 거의 100 % 효율이 없습니다. 여기서는 분화 후 CXCR4 + 세포군의 정제 방법을 서술자기 마이크로 비드를 사용하여 DE에. 이 정제는 또한 원치 않는 계통의 세포를 제거합니다. 부드러운 정제 방법은 신속하고 신뢰성 및 하류 어플리케이션 및 분화를 개선하는 데 사용될 수있다.
Introduction
배아 줄기 세포 (는 ESC)와 같은 다 능성 줄기 세포는 신체의 거의 모든 세포 유형으로 분화 할 수있는 능력을 가지고있다. 따라서, 생체 외 분화 프로토콜은 심근 1 간세포 2, 3 베타 세포, 폐 상피 4 또는 5 신경 세포 등 다양한 성인 세포 유형을 생성하기 위해 사용될 수있다. 이는 ESC에게 다양한 퇴행성 질환 (3)의 잠재적 인 치료를위한 유용한 도구를 만든다.
폐, 간, 췌장의 성인 조직으로는 ESC의 체외 분화는 최종 내배엽 (DE) 6 연상 세포로 의사 낭 배기가 필요합니다. 상기 체세포 유형 하류쪽으로 분화 상당히 비효율적이기 때문에, 최적의 내배엽 분화는 7 레이트 제한으로 간주된다. 내배엽 계통을 향해 최선을 다하고 있습니다 세포는 차를 받다이들 유전자 발현 프로파일 racteristic 변한다. 능성 마스터 조절 유전자 다운 규제 예 9. CXCR4가 된 Smad2 의해 transactivated 것으로 알려져 FOXA2, SOX17, HNF1B, GATA 가족 구성원과 CXCR4 높은 6 상향 조절되어 표면 수용체 (8)과 같은 다른 전사 인자의 발현 반면 / 3, 인해 프로모터 영역 (10)의 특정 결합 부위에 결절 / TGF-β 신호 및 SOX17의 하류. 따라서 리포트 6, 8, 11 ~ 13의 번호를 사용 매우 적합한 마커이다. 이러한 발현 변화는 ESC는 먼저 기본 연속 형 세포 집단의 특성을 획득하고이어서 배아 내배엽 층 (6)에 투입하는 의사 낭배 이벤트를 반영한다.
몇 세포가 분화 과정에 저항 또는 다른 의도하지 않은 계통 (14)으로 구별 할 수있다 그러나, 분화 프로토콜은 거의 100 % 효율이 없습니다. 이러한 세포 부정적인 influe있다후부 더 차별화. 또한, 잔여 미분화 세포는 나중에 이식 실험에 대한 큰 위험을 항구 및 기형 종 15-17을 야기 할 수 있습니다.
초기에 표면 마커 CXCR4 드 (18)를 향해 최선을 다하고 있습니다 세포의 정제에 사용할 수있는 이러한 원치 않는 세포를 제거합니다. 여기서는 DE 분화 배양에서 CXCR4 + 세포의 양성 선별을위한 방법을 설명한다. 이를 위해 표면 마커 CXCR4 후 다시 자성 마이크로 비드에 결합 된 항체에 의해 결합된다. FACS 정렬 동안 가혹한 조건 달리 자기 표지 DE 같은 세포를 쉽게 부드러운 정제 방법을 사용하여 벤치 탑 형태로 정제 될 수있다. 이 프로토콜은 DE 분화 과정 저항 세포 집단을 제거하기위한 간단한 방법을 제공한다.
Protocol
Representative Results
Discussion
현재 사용 분화 프로토콜은 거의 100 % 차별화 된 세포에서 발생합니다. 아직 해결해야 할 몇 가지 이유로 세포 분화 과정 레지스트. 사용 된 분화 프로토콜의 효율 및 ESC의 성향에 따라 잔류 다 능성 세포의 소정 수는 일반적으로, 심지어 최종 내배엽으로 분화 후에 관찰되는 광고. 이러한 잔류 세포는 transcriptomics, 단백질 체학 및 miRNA의 발현 분석 등 다운 스트림 분화 또는 추가 분석을 방해 할 수 …
Divulgations
The authors have nothing to disclose.
Acknowledgements
재스민 Kresse의 숙련 된 기술 지원은 기꺼이 인정 받고 있습니다.
Materials
| Hues8 human embryonic stem cell line | Harvard Department of stem cell & regenerative biology | NA | Suitable cell line for endoderm generation |
| Hes3 human embryonic stem cell line | ES Cell International | NA | Suitable and robust cell line for endoderm generation |
| mTeSR1 | Stemcell Technologies | 5850 | ESC culture medium |
| FCS | Biowest | S1860 | |
| Advanced RPMI 1640 | Life Technologies | 12633012 | |
| CD184 (CXCR4)-APC, human | Miltenyi Biotec | 130-098-357 | |
| anti-APC MicroBeads | Miltenyi Biotec | 130-090-855 | |
| OctoMACS Separator | Miltenyi Biotec | 130-042-109 | magnetic field |
| Y-27632 | Selleck Chemicals | S1049 | ROCK inhibitor |
| CHIR-99021 | Tocris Bioscience | 4423 | |
| Activin A | Peprotech | 120-14 | |
| Gentle Cell Dissociation Reagent | Stemcell Technologies | 7174 | Enzyme-free passaging solution, alternative: Trypsin/EDTA |
| Matrigel* | Corning | 354277 | basement membrane matrix * solve and store in aliquots at -80 °C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12. Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature. Remove the matrigel and use immediately. |
| MS Columns | Miltenyi Biotec | 30-042-201 | |
| MACS Separator | Miltenyi Biotec | 130-042-302 | |
| Human FOXA2 FW gggagcggtgaagatgga |
Life Technologies | NA | |
| Human FOXA2 REV tcatgttgctcacggaggagta |
Life Technologies | NA | |
| Human GSC FW gaggagaaagtggaggtctggtt |
Life Technologies | NA | |
| Human GSC REV ctctgatgaggaccgcttctg |
Life Technologies | NA | |
| SOX17 TaqMan assay | Applied Biosystems | Hs00751752_s1 | |
| Human SOX7 FW gatgctgggaaagtcgtggaagg |
Life Technologies | NA | |
| Human SOX7 REV tgcgcggccggtacttgtag |
Life Technologies | NA | |
| Human POU5F1 FW cttgctgcagaagtgggtggagg |
Life Technologies | NA | |
| Human POU5F1 REV ctgcagtgtgggtttcgggca |
Life Technologies | NA | |
| Human Nanog FW ccgagggcagacatcatcc |
Life Technologies | NA | |
| Human Nanog REV ccatccactgccacatcttct |
Life Technologies | NA | |
| Human TBP FW caa cag cct gcc acc tta cgc tc |
Life Technologies | NA | |
| Human TBP REV agg ctg tgg ggt cag tcc agt g |
Life Technologies | NA | |
| Human TUBA1A FW ggc agt gtt tgt aga ctt gga acc c |
Life Technologies | NA | |
| Human TUBA1A REV tgt gat aag ttg ctc agg gtg gaa g |
Life Technologies | NA | |
| Human G6PD FW agg ccg tca cca aga aca ttc a |
Life Technologies | NA | |
| Human G6PD REV cga tga tgc ggt tcc agc cta t |
Life Technologies | NA | |
| Anti-SOX2 | Santa Cruz Biotechnology | sc-17320 | |
| Anti-FOXA2 | MerckMillipore | 07-633 | |
| Anti-SOX17 | R&D Systems | AF1924 | |
| NA = not applicable |
References
- Sharma, A., Li, G., Rajarajan, K., Hamaguchi, R., Burridge, P.W., Wu, S.M. Derivation of Highly Purified Cardiomyocytes from Human Induced Pluripotent Stem Cells Using Small Molecule-modulated Differentiation and Subsequent Glucose Starvation. J Vis Exp. (97), (2015).
- Sgodda, M., et al. Improved hepatic differentiation strategies for human induced pluripotent stem cells. Curr Mol Med. 13 (5), 842-855 (2013).
- Naujok, O., Burns, C., Jones, P.M., Lenzen, S. Insulin-producing surrogate beta-cells from embryonic stem cells: are we there yet? Mol Ther. 19 (10), 1759-1768 (2011).
- Katsirntaki, K., et al. Bronchoalveolar sublineage specification of pluripotent stem cells: effect of dexamethasone plus cAMP-elevating agents and keratinocyte growth factor. Tissue Eng Part A. 21 (3-4), 669-682 (2015).
- Abranches, E., et al. Neural differentiation of embryonic stem cells in vitro: a road map to neurogenesis in the embryo. PLoS One. 4 (7), e6286 (2009).
- Naujok, O., Diekmann, U., Lenzen, S. The generation of definitive endoderm from human embryonic stem cells is initially independent from activin A but requires canonical Wnt-signaling. Stem Cell Rev. 10 (4), 480-493 (2014).
- D'Amour, K.A., et al. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat Biotechnol. 24 (11), 1392-1401 (2006).
- Diekmann, U., Lenzen, S., Naujok, O. A reliable and efficient protocol for human pluripotent stem cell differentiation into the definitive endoderm based on dispersed single cells. Stem Cells Dev. 24 (2), 190-204 (2015).
- Kim, P.T., Ong, C.J. Differentiation of definitive endoderm from mouse embryonic stem cells. Results Probl Cell Differ. 55 303-319 (2012).
- Katoh, M., Katoh, M. Integrative genomic analyses of CXCR4: transcriptional regulation of CXCR4 based on TGFbeta, Nodal, Activin signaling and POU5F1, FOXA2, FOXC2, FOXH1, SOX17, and GFI1 transcription factors. Int J Oncol. 36 (2), 415-420 (2010).
- Nostro, M.C., et al. Stage-specific signaling through TGFbeta family members and WNT regulates patterning and pancreatic specification of human pluripotent stem cells. Development. 138 (5), 861-871 (2011).
- Rezania, A., et al. Maturation of human embryonic stem cell-derived pancreatic progenitors into functional islets capable of treating pre-existing diabetes in mice. Diabetes. 61 (8), 2016-2029 (2012).
- Bruin, J.E., et al. Maturation and function of human embryonic stem cell-derived pancreatic progenitors in macroencapsulation devices following transplant into mice. Diabetologia. 56 (9), 1987-1998 (2013).
- Fu, W., Wang, S.J., Zhou, G.D., Liu, W., Cao, Y., Zhang, W.J. Residual undifferentiated cells during differentiation of induced pluripotent stem cells in vitro and in vivo. Stem Cells Dev. 21 (4), 521-529 (2012).
- Hentze, H., Soong, P.L., Wang, S.T., Phillips, B.W., Putti, T.C., Dunn, N.R. Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies. Stem Cell Res. 2 (3), 198-210 (2009).
- Herberts, C.A., Kwa, M.S., Hermsen, H.P. Risk factors in the development of stem cell therapy. J Transl Med. 9 29 (2011).
- Naujok, O., Kaldrack, J., Taivankhuu, T., Jörns, A., Lenzen, S. Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment. Stem Cell Rev. 6 (3), 450-461 (2010).
- Pan, Y., Ouyang, Z., Wong, W.H., Baker, J.C. A new FACS approach isolates hESC derived endoderm using transcription factors. PLoS One. 6 (3), e17536 (2011).
