High-throughput CRISPR Vector Constructie en karakterisering van DNA Wijzigingen van Generation van Tomato Hairy Roots
Summary
Met behulp van DNA assembly kunnen meerdere CRISPR vectoren parallel worden geconstrueerd in een enkele klonen reactie, waardoor de bouw van grote aantallen vectoren CRISPR een eenvoudige taak. Tomaat harige wortels zijn een uitstekend model systeem om CRISPR vectoren te valideren en het genereren van mutant materialen.
Abstract
Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for functional genomics studies. While most cloning strategies are simple to perform, they generally use multiple steps and can require several days to generate the ultimate constructs. The method presented here is based on DNA assembly and can produce fully functional CRISPR vectors in a single cloning reaction. Vector construction can also be pooled, further increasing the efficiency and utility of the process. A modification of the method is used to create CRISPR vectors with multiple gene targets. CRISPR vectors are then transformed into tomato hairy roots to generate transgenic materials with targeted DNA modifications. Hairy roots are a useful system for testing vector functionality as they are technically simple to generate and amenable to large-scale production. The methods presented here will have wide application as they can be used to generate a variety of CRISPR vectors and be used in a wide range of plant species.
Introduction
De mogelijkheid om gerichte DNA wijzigingen met CRISPR genereren / Cas9 heeft een groot potentieel voor functionele genomica studies. Er zijn twee onderdelen van het CRISPR / Cas9 systeem; de Cas9 nuclease afgeleid van Staphylococcus pyogenes en een ongeveer 100-nt guide RNA (gRNA) molecuul dat Cas9 doorstuurt naar de target DNA site (s) 1. Beeldherkenning wordt verleend door de eerste ~ 20-nt van het gRNA, die zorgt voor high-throughput productie van richtende vectoren 2,3. De meeste organismen die kunnen worden gemanipuleerd, reeds CRISPR / Cas9 technologie 4,5 hebben.
In planten, constitutieve promoters, zoals de CaMV 35S promotor, worden vaak gebruikt om de expressie van de Cas9 nuclease 6 rijden. De gRNAs worden uitgedrukt in het RNA-polymerase III U6 en U3 promotors die de eerste base van het gRNA beperkt tot hetzij een G voor U6 of A U3, voor efficiënte transcriptie. Maar RNA-polymerase II promoters, die vrij zijn van deze beperkingen zijn, zijn ook gebruikt 7,8.
Verschillende gRNAs induceren DNA-mutaties met verschillende rendementen, en dus kan het belangrijk zijn om eerst te valideren CRISPR geblokkeerd voordat investeren in hele plant transformaties of het opzetten van een uitgebreide fenotypische schermen. Tijdelijke expressie van CRISPR constructen in planten, met agroinfiltration bijvoorbeeld algemeen in een lagere frequentie van DNA modificatie vergeleken met stabiele planten 6, wat detectie van mutaties en fenotypische testen moeilijk onpraktisch met dergelijke benaderingen. Zogenaamde haarwortels is een handig, alternatief systeem aangezien een groot aantal onafhankelijke stabiel getransformeerde materialen binnen weken kan worden gegenereerd, in plaats van maanden stabiele planten. CRISPR vectoren zijn zeer effectief in het induceren van mutaties in DNA haarwortels 9,10.
DNA assemblagemethoden efficiënt ligeren DNA-fragmenten die overlapping 11 eindigt. Een belangrijk voordeel van een aantal DNA montagemethoden is de mogelijkheid om ssDNA (dwz oligo) nemen in de samengestelde producten. Aangezien gRNAs slechts ~ 20-nt lange en nieuwe doelen kunnen worden gesynthetiseerd met oligo deze DNA montagemethoden zijn geschikt voor CRISPR klonen. De hier beschreven protocollen zijn gebaseerd op de P201 serie CRISPR vectoren die met succes is toegepast in sojabonen 10, 12 en populier nu tomaat. De kloneringswerkwijze gepresenteerd biedt verscheidene voordelen boven de huidige werkwijze 10 klonen. Namelijk, kan volledig functionele vectoren in één klonen reactie in een enkele dag worden gegenereerd. Vector constructie kan ook worden samengevoegd om meerdere CRISPR vectoren parallel genereren, hands-on tijd en materiële kosten verder te verlagen. Ook presenteren een protocol voor het genereren van tomaat haarwortels een efficiënte methode om transgene materialen doelgen deleties te produceren. Harige wortels worden gebruikt om geldigeat de CRISPR vectoren en voorzien materiaal voor verdere experimenten.
Protocol
Representative Results
Discussion
Since DNA assembly is used to recombine any overlapping DNA sequences, this cloning method can be applied to any CRISPR vector construction. Most CRISPR cloning schemes use either gene synthesis of the gRNA, type IIS restriction enzymes17,18, or overlap-extension PCR19. Each of these techniques has inherent advantages and disadvantages, but they typically require multiple hands-on cloning steps. The primary advantage of the cloning method presented here is that the entire process occurs in a single,…
Divulgations
The authors have nothing to disclose.
Acknowledgements
Dit onderzoek werd gesteund door de National Science Foundation subsidie IOS-1025642 (GBM). Wij danken Maria Harrison voor het verstrekken van de ARqua1 stam.
Materials
| NEBuilder® (HiFi DNA assembly mix) | New England Biolabs | E5520 | |
| p201N:Cas9 | Addgene | 59175 | The p201H:Cas9 plasmid (59176) is also compatible with the reported overlaps and enzymes. |
| pUC gRNA Shuttle | Addgene | 47024 | |
| SwaI | New England Biolabs | R0604S | |
| SpeI | New England Biolabs | R0133S | |
| Zymo clean and concentrator-5 column purification | Zymo Research | D4003 | |
| NEB Buffer 2.1 | New England Biolabs | B7202S | |
| NEB CutSmart (Buffer 4) | New England Biolabs | B7204S | |
| NEB Buffer 3.1 | New England Biolabs | B7203S | |
| EconoSpin Mini Spin Column (plasmid prep) | Epoch Life Sciences | 1910-050/250 | |
| EcoRV-HF® | New England Biolabs | R3195S | |
| StyI-HF® | New England Biolabs | R3500S | |
| MS Salts + Gamborg Vitamins | Phytotechnology Laboratories | M404 | |
| Phytagel™ (gellan gum) | Sigma Aldrich | P8169 | |
| GA-7 Boxes | Sigma Aldrich | V8505 | |
| Micropore™ surgical tape | 3M | 1535-0 | |
| Timentin® (Ticarcillin/Clavulanic acid) | Various | 0029-6571-26 | |
| Primers 5' -> 3' | |||
| SwaI_MtU6F | GATATTAATCTCTTCGATGAAATTTATGCCTATCTTATATGATCAATGAGG | ||
| MtU6R | AAGCCTACTGGTTCGCTTGAAG | ||
| ScaffoldF | GTTTTAGAGCTAGAAATAGCAAGTT | ||
| SpeI_Scaffold R | GTCATGAATTGTAATACGACTCAAAAAAAAGCACCGACTCGGTG | ||
| StUbi3P218R | ACATGCACCTAATTTCACTAGATGT | ||
| ISceIR | GTGATCGATTACCCTGTTATCCCTAG | Cannot be used for Sanger sequencing since there is a second binding site on the plasmid | |
| UNS1_Scaffold R | GAGAATGGATGCGAGTAATGAAAAAAAGCACCGACTCGGTG | ||
| UNS1_MtU6 F | CATTACTCGCATCCATTCTCATGCCTATCTTATATGATCAATGAGG | ||
| p201R | CGCGCCGAATTCTAGTGATCG | ||
| Bolded sequences denote 20-nt overlaps with linearized p201N:Cas9. | |||
References
- Jinek, M., et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337 (6096), 816-821 (2012).
- Shalem, O., et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 343 (6166), 84-87 (2014).
- Zhou, Y. X., et al. High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells. Nature. 509 (509), 487-491 (2014).
- Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346 (6213), (2014).
- Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Patron, N. J., Nekrasov, V. Editing plant genomes with CRISPR/Cas9. Current Opinion in Biotechnology. 32, 76-84 (2015).
- Bortesi, L., Fischer, R. The CRISPR/Cas9 system for plant genome editing and beyond. Biotechnology Advances. 33 (1), 41-52 (2015).
- Jia, H. G., Wang, N. Targeted genome editing of sweet orange using Cas9/sgRNA. Plos One. 9, (2014).
- Upadhyay, S. K., Kumar, J., Alok, A., Tuli, R. RNA-Guided Genome Editing for Target Gene Mutations in Wheat. G3-Genes Genomes Genetics. 3 (12), 2233-2238 (2013).
- Ron, M., et al. Hairy root transformation using Agrobacterium rhizogenes. as a tool for exploring cell type-specific gene expression and function using tomato as a model. Plant Physiology. 166 (2), 455-U4442 (2014).
- Jacobs, T. B., LaFayette, P. R., Schmitz, R. J., Parrott, W. A. Targeted genome modifications in soybean with CRISPR/Cas9. BMC Biotechnology. 15, (2015).
- Gibson, D. G., Smith, H. O., Hutchison, C. A., Venter, J. C., Merryman, C. Chemical synthesis of the mouse mitochondrial genome. Nature Methods. 7 (11), 901-903 (2010).
- Zhou, X., Jacobs, T. B., Xue, L. J., Harding, S. A., Tsai, C. J. Exploiting SNPs for biallelic CRISPR mutations in the outcrossing woody perennial Populus reveals 4-coumarate:CoA ligase specificity and redundancy. New Phytologist. , (2015).
- Stemmer, M., Thumberger, T., Keyer, M. D., Wittbrodt, J., Mateo, J. L. CCTop: An Intuitive, Flexible and Reliable CRISPR/Cas9 Target Prediction Tool. Plos One. 10, (2015).
- Lei, Y., et al. CRISPR-P: A Web Tool for Synthetic Single-Guide RNA Design of CRISPR-System in Plants. Molecular Plant. 7 (9), 1494-1496 (2014).
- Quandt, H. J., Puhler, A., Broer, I. TRANSGENIC ROOT-NODULES OF VICIA-HIRSUTA – A FAST AND EFFICIENT SYSTEM FOR THE STUDY OF GENE-EXPRESSION IN INDETERMINATE-TYPE NODULES. Molecular Plant-Microbe Interactions. 6, 699-706 (1993).
- Zhu, X. X., et al. An efficient genotyping method for genome-modified animals and human cells generated with CRISPR/Cas9 system. Scientific Reports. 4 (8), (2014).
- Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Nekrasov, V. Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system. Plant Methods. 9 (1), 39 (2013).
- Cong, L., et al. Multiplex genome engineering using CRISPR/Cas systems. Science. 339 (6121), 819-823 (2013).
- Li, J. F., et al. Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nat Biotech. 31 (8), 688-691 (2013).
- Fu, Y. F., Sander, J. D., Reyon, D., Cascio, V. M., Joung, J. K. Improving CRISPR-Cas nuclease specificity using truncated guide RNAs. Nature Biotechnology. 32 (3), 279-284 (2014).
- Torella, J. P., et al. Unique nucleotide sequence-guided assembly of repetitive DNA parts for synthetic biology applications. Nat Protoc. 9 (9), 2075-2089 (2014).
- Ono, N. N., Tian, L. The multiplicity of hairy root cultures: Prolific possibilities. Plant Science. 180 (3), 439-446 (2011).
- Tepfer, D. Transformation of several species of higher plants by Agrobacterium rhizogenes.: sexual transmission of the transformed genotype and phenotype. Cell. 37 (3), 959-967 (1984).
- Li, H., Deng, Y., Wu, T. L., Subramanian, S., Yu, O. Misexpression of miR482, miR1512, and miR1515 Increases Soybean Nodulation. Plant Physiology. 153 (4), 1759-1770 (2010).
- Boisson-Dernier, A., et al. Agrobacterium rhizogenes-transformed roots of Medicago truncatula for the study of nitrogen-fixing and endomycorrhizal symbiotic associations. Molecular Plant-Microbe Interactions. 14 (6), 695-700 (2001).
- Collier, R., Fuchs, B., Walter, N., Kevin Lutke, W., Taylor, C. G. Ex vitro. composite plants: an inexpensive, rapid method for root biology. Plant Journal. 43 (3), 449-457 (2005).
