A sensitive and accurate method for cell-free microRNAs quantification using a dye-based chemistry and droplet digital PCR technology is described.
마이크로 RNA (miRNA가) (무 세포들)은 순환 혈류로 세포로부터 방출된다. 순환 특정 마이크로 RNA의 양은 질병 상태에 연결된 질병 표지자로서 사용될 수있는 잠재력을 가지고있다. 디지털 PCR 기술 염료 계 화학 제를 사용하여 액적 마이크로 RNA 정량화를 순환 민감하고 정확한 방법이 최근 개발되고있다. 구체적으로, 핵산 (LNA)을 그 고유의 miRNA의 절대 정량을 얻을 수있다 호환 액적 디지털 PCR 시스템에서 녹색 형광 DNA 결합 염료 miRNA에 특이 적 프라이머를 사용하여 잠김 기반. 여기, 우리는이 기술을 수행하는 플라즈마 및 혈청 등의 생물학적 유체에서 miRNA의 양을 평가하는 방법을 설명, 가능하고 효과적이다.
MicroRNAs (miRNAs) are released into blood circulation by potentially all the cells of the organism, as a consequence of active release or necrotic and apoptotic processes. Cell-free miRNAs have been detected in the bloodstream either as free stable molecules or linked to lipoproteins or enveloped inside exosomes and microvesicles 1-3. They are believed to function as cell-to-cell communicators 4, and their amount changes in the presence of cancer, cardiac disorders or autoimmune diseases 5-7. Their accurate and reproducible quantification is the basis for their evaluation as disease biomarkers. However, for several reasons already described elsewhere 8,9, miRNA quantification in serum or plasma, as well as other body fluids, could be very challenging 10,11. We recently developed a method for the absolute quantification of circulating miRNAs, based on miRNA-specific LNA primers and DNA-binding dye droplet digital PCR (ddPCR) technology 12. This methodology has been applied to the validation of miRNA breast cancer biomarkers 13,14.
After the partitioning of each reverse-transcribed miRNA molecule inside a nanoliter-sized droplet, it is possible to count the copy number of each miRNA in each sample, basically counting the number of green, and therefore positive, fluorescent droplets. As soon as a PCR reaction occurs, a positive count is achieved, without the need to establish a standard curve or taking PCR efficiency into account in target amount calculation, as it happens with quantitative RT-PCR (RT-qPCR). In addition, ddPCR proved to be more sensitive and accurate than RT-qPCR in circulating miRNA quantification 15. In this article we present the detailed protocol of this methodology, discussing the most relevant steps andspecifically considering serum and plasma clinical samples.
순환의 miRNAs는 매우 낮은 농도에서 혈액 내 존재하는 혈장 및 혈청 샘플에서 추출 할 수있는 RNA의 양이 적다. 이 때문에, 그것들은 마이크로 어레이 및 RNA 서열 분석과 같은 다른 기술을 정량화하기 어렵다. 또한, 데이터의 정규화 계약 일반화 부족 혈중 내인성 "참조"의 miRNAs의 존재가있다. 이러한 맥락에서, 혈청 또는 혈장해도 매우 낮은 1 ㎖ 당 miRNA의 매수를 카운트 할 수있는 액적 디지?…
The authors have nothing to disclose.
(-, 15분의 2,010 9,980 5 밀레 N 당. 특별 프로그램 분자 임상 종양)와, 대학 수업의 이탈리아 교육부에서 MF (MFAG 11676)에 암 연구를위한 이탈리아 협회 (AIRC)로부터 MN에 자금을 지원하는 MN에 대한 연구 FIRB 2011 (프로젝트 RBAPIIBYNP).
miRNeasy Mini Kit | Qiagen | 217004 | Columns for total RNA, including miRNA, extraction from serum/plasma |
100 nmole RNA oligo Cel-miR-39-3p | Integrated DNA Technologies | Custom | Sequence: UCACCGGGUGUAAAUCAGCUUG |
Universal cDNA synthesis kit II, 8-64 rxns | Exiqon | 203301 | Kit for microRNA reverse transcription |
MicroRNA LNA PCR primer set | Exiqon | 204000-206xxx and 2100000-21xxxxx | Primers for miRNA amplification inside droplets |
QX200 droplet generator | BioRad | 186-4002 | Instrument used for droplet reading |
QX200 droplet reader | BioRad | 186-4003 | Instrument used for droplet generation |
QuantaSoft software | BioRad | 186-3007 | Software for data collection and analysis |
PX1 PCR plate sealer | BioRad | 181-4000 | Plate sealer |
DG8 droplet generator cartridges and gaskets | BioRad | 186-4008 | Cartridges used to mix sample and oil to generate droplets |
QX200 ddPCR EvaGreen supermix | BioRad | 186-4033/36 | PCR supermix |
QX200 droplet generator oil for EvaGreen dye | BioRad | 186-4005 | Oil for droplet generation |