A sensitive and accurate method for cell-free microRNAs quantification using a dye-based chemistry and droplet digital PCR technology is described.
Циркулирующие (бесклеточных) микроРНК (миРНК) освобождаются из клеток в кровоток. Количество специфических микроРНК в обращении было связано с болезненным состоянием и имеет потенциал для использования в качестве биомаркеров заболеваний. Чувствительный и точный метод циркулирующих микроРНК количественной оценки с использованием химии на основе красителя и капелька цифровые технологии ПЦР была недавно разработана. В частности, с использованием Закрытые нуклеиновых кислот (LNA) основе микроРНК специфических праймеров, с зеленым флуоресцентным ДНК-связывающего красителя в совместимой капельной системе цифровой ПЦР, то можно получить абсолютное количественное определение специфических микроРНК. Здесь мы опишем, как выполнять эту технику, чтобы оценить количество микроРНК в биологических жидкостях, таких как плазма и сыворотки, является возможным и эффективным.
MicroRNAs (miRNAs) are released into blood circulation by potentially all the cells of the organism, as a consequence of active release or necrotic and apoptotic processes. Cell-free miRNAs have been detected in the bloodstream either as free stable molecules or linked to lipoproteins or enveloped inside exosomes and microvesicles 1-3. They are believed to function as cell-to-cell communicators 4, and their amount changes in the presence of cancer, cardiac disorders or autoimmune diseases 5-7. Their accurate and reproducible quantification is the basis for their evaluation as disease biomarkers. However, for several reasons already described elsewhere 8,9, miRNA quantification in serum or plasma, as well as other body fluids, could be very challenging 10,11. We recently developed a method for the absolute quantification of circulating miRNAs, based on miRNA-specific LNA primers and DNA-binding dye droplet digital PCR (ddPCR) technology 12. This methodology has been applied to the validation of miRNA breast cancer biomarkers 13,14.
After the partitioning of each reverse-transcribed miRNA molecule inside a nanoliter-sized droplet, it is possible to count the copy number of each miRNA in each sample, basically counting the number of green, and therefore positive, fluorescent droplets. As soon as a PCR reaction occurs, a positive count is achieved, without the need to establish a standard curve or taking PCR efficiency into account in target amount calculation, as it happens with quantitative RT-PCR (RT-qPCR). In addition, ddPCR proved to be more sensitive and accurate than RT-qPCR in circulating miRNA quantification 15. In this article we present the detailed protocol of this methodology, discussing the most relevant steps andspecifically considering serum and plasma clinical samples.
Циркулирующие микроРНК присутствуют в крови при очень низких концентрациях, и количество РНК, которые могут быть извлечены из плазмы и сыворотки крови низка. По этой причине, их трудно количественно с другими методами, такими как микрочипов и РНК-последовательности. Кроме того, сущест?…
The authors have nothing to disclose.
При поддержке финансирования из итальянской ассоциации по исследованию рака (AIRC) к MF (MFAG 11676) и MN (Специальная программа молекулярной клинической онкологии. – 5 промилле п 9980, 2010/15) и от итальянского Министерства обучения, университет и Исследования FIRB 2011 для MN (Project RBAPIIBYNP).
miRNeasy Mini Kit | Qiagen | 217004 | Columns for total RNA, including miRNA, extraction from serum/plasma |
100 nmole RNA oligo Cel-miR-39-3p | Integrated DNA Technologies | Custom | Sequence: UCACCGGGUGUAAAUCAGCUUG |
Universal cDNA synthesis kit II, 8-64 rxns | Exiqon | 203301 | Kit for microRNA reverse transcription |
MicroRNA LNA PCR primer set | Exiqon | 204000-206xxx and 2100000-21xxxxx | Primers for miRNA amplification inside droplets |
QX200 droplet generator | BioRad | 186-4002 | Instrument used for droplet reading |
QX200 droplet reader | BioRad | 186-4003 | Instrument used for droplet generation |
QuantaSoft software | BioRad | 186-3007 | Software for data collection and analysis |
PX1 PCR plate sealer | BioRad | 181-4000 | Plate sealer |
DG8 droplet generator cartridges and gaskets | BioRad | 186-4008 | Cartridges used to mix sample and oil to generate droplets |
QX200 ddPCR EvaGreen supermix | BioRad | 186-4033/36 | PCR supermix |
QX200 droplet generator oil for EvaGreen dye | BioRad | 186-4005 | Oil for droplet generation |