Een protocol voor Functionele Evaluatie van Whole-Protein verzadigingsmutagenese Bibliotheken Met behulp van High-throughput sequencing
Summary
We presenteren een protocol voor de functionele beoordeling van de uitgebreide single-site verzadigingsmutagenese bibliotheken van eiwitten met behulp van high-throughput sequencing. Belangrijk is dat deze aanpak maakt gebruik van orthogonale primer paren bibliotheek bouw en sequencing multiplexen. Representatieve resultaten met behulp van TEM-1 β-lactamase gekozen klinisch relevante dosering van ampicilline wordt verschaft.
Abstract
Site-directed mutagenesis has long been used as a method to interrogate protein structure, function and evolution. Recent advances in massively-parallel sequencing technology have opened up the possibility of assessing the functional or fitness effects of large numbers of mutations simultaneously. Here, we present a protocol for experimentally determining the effects of all possible single amino acid mutations in a protein of interest utilizing high-throughput sequencing technology, using the 263 amino acid antibiotic resistance enzyme TEM-1 β-lactamase as an example. In this approach, a whole-protein saturation mutagenesis library is constructed by site-directed mutagenic PCR, randomizing each position individually to all possible amino acids. The library is then transformed into bacteria, and selected for the ability to confer resistance to β-lactam antibiotics. The fitness effect of each mutation is then determined by deep sequencing of the library before and after selection. Importantly, this protocol introduces methods which maximize sequencing read depth and permit the simultaneous selection of the entire mutation library, by mixing adjacent positions into groups of length accommodated by high-throughput sequencing read length and utilizing orthogonal primers to barcode each group. Representative results using this protocol are provided by assessing the fitness effects of all single amino acid mutations in TEM-1 at a clinically relevant dosage of ampicillin. The method should be easily extendable to other proteins for which a high-throughput selection assay is in place.
Introduction
Mutagenese al lang toegepast in het laboratorium om de eigenschappen van biologische systemen en hun evolutie en mutante eiwitten of organismen produceren met verbeterde of nieuwe functies. Terwijl vroege benaderingen gebruikt methoden die willekeurige mutaties in organismen produceren, de komst van recombinant DNA-technologie konden de onderzoekers selecteren veranderingen aan DNA in een plaatsspecifieke wijze, bijv. Plaatsgerichte mutagenese 1,2 voeren. Met de huidige technieken, meestal met behulp van mutagene oligonucleotiden in een polymerase kettingreactie (PCR), is het relatief gemakkelijk om kleine aantallen mutaties (bijv., Puntmutaties) in een bepaald gen 3,4 creëren en te beoordelen. Het is echter veel moeilijker, wanneer het doel nadert, bijvoorbeeld de creatie en evaluatie van alle mogelijke single-site (of hogere orde) mutaties.
Er is al veel geleerd van vroege studies proberen om grote aantallen m beoordelenutations in genen, de toegepaste methoden waren vaak moeizaam, bijvoorbeeld waarbij de beoordeling van elke mutatie afzonderlijk gebruikt nonsense suppressor stammen 5-7, of werden de kwantitatieve vermogen beperkt vanwege de geringe diepte van Sanger sequentiebepaling sequentiebepaling 8. De technieken die in deze studies zijn grotendeels verdrongen door werkwijzen die gebruik maken high-throughput sequencing technologie 9-12. Deze conceptueel eenvoudige benaderingen behelzen het creëren van een bibliotheek omvattende een groot aantal mutaties, het onderwerpen van de bibliotheek om een scherm of selectie voor de functie, en diep-sequencing (bijv. In de orde van> 10 6 sequencing gelezen) de bibliotheek verkregen voor en na selectie. Zo de fenotypische of geschiktheid effecten van een groot aantal mutaties, weergegeven als de verandering in de frequentie bevolking van elke mutant, gelijktijdig en kwantitatief worden beoordeeld.
We hebben eerder introduceerde een simp(. dwz gehele eiwit verzadigingsmutagenese bibliotheken) le benadering voor het keuren bibliotheken van alle mogelijke enkele aminozuur mutaties in proteïnen, van toepassing op genen met een lengte langer dan de sequentiebepaling leest lengte 11,13: Ten eerste, elke aminozuurpositie gerandomiseerd door plaatsgerichte mutagene PCR. Tijdens dit proces wordt het gen verdeeld in groepen bestaande uit aaneengesloten posities met een totale lengte opgevangen door het platform sequencing. De mutagene PCR-producten voor elke groep worden vervolgens gecombineerd en elke groep onafhankelijk onderworpen aan selectie en high-throughput sequencing. Door een overeenkomst tussen de locatie mutaties in de sequentie en de sequentie gelezen lengte, deze benadering het voordeel van het maximaliseren sequencing diepte: terwijl men eenvoudig kan sequencen dergelijke bibliotheken in korte vensters zonder opsplitsing in groepen (bijvoorbeeld door een standaard geweer. sequencing aanpak), de meeste leest verkregen zouden wild-type en dus de m bedragenajority sequencing throughput verloren (bijvoorbeeld voor een gehele eiwit verzadigingsmutagenese bibliotheek van een 500 aminozuur proteïne gesequenced 100 aminozuren (300 bp) glas ten minste 80% van leest de wild-type sequentie).
Hier wordt een protocol voorgelegd die high-throughput sequentiebepaling gebruikt voor de functionele beoordeling van gehele eiwitten verzadigingsmutagenese bibliotheken met behulp van voornoemde benadering (geschetst in figuur 1). Belangrijker introduceren we het gebruik van orthogonale primers in de bibliotheek kloonproces elke reeksgroep, waardoor ze te multiplexen in een bibliotheek, gelijktijdig onderworpen aan screening of selectie barcode, en vervolgens de-gemultiplext voor diepe sequencing. Aangezien de sequentie groepen niet afzonderlijk worden onderworpen aan selectie, vermindert de werkdruk en zorgt ervoor dat elke mutatie ervaart hetzelfde selectie. TEM-1 β-lactamase, een enzym dat een hoge resistentie verleent tegenβ-lactam antibiotica (bv. ampicilline) in bacteriën wordt gebruikt als modelsysteem 14-16. Een protocol is beschreven voor de beoordeling van een geheel eiwit verzadigingsmutagenese bibliotheek van TEM-1 in E. coli onder selectiedruk bij een benaderde serumniveau een klinische dosis van ampicilline (50 ug / ml) 17,18.
Protocol
Representative Results
Discussion
Hier een protocol beschreven voor het uitvoeren van de functionele beoordeling van gehele eiwitten verzadigingsmutagenese bibliotheken, met behulp van high-throughput sequencing technologie. Een belangrijk aspect van de werkwijze is het gebruik van orthogonale primers tijdens het klonen. Kort samengevat, wordt elke aminozuurpositie gerandomiseerd door mutagene PCR en gemengd in groepen van posities waarvan de totale sequentielengte wordt opgevangen door high-throughput sequencing. Deze groepen worden gekloneerd in plasm…
Divulgations
The authors have nothing to disclose.
Acknowledgements
R.R. acknowledges support from the National Institutes of Health (RO1EY018720-05), the Robert A. Welch Foundation (I-1366), and the Green Center for Systems Biology.
Materials
| Typtone | Research Products Intl. Corp. | T60060-1000.0 | |
| Yeast extract | Research Products Intl. Corp. | Y20020-500.0 | |
| Sodium chloride | Fisher Scientific | BP358-212 | |
| Potassium chloride | Sigma-Aldrich | P9333-500G | |
| Magnesium sulfate | Sigma-Aldrich | M7506-500G | |
| Agar | Fisher Scientific | BP1423-500 | |
| Tetracycline hydrochloride | Sigma-Aldrich | T7660-5G | |
| petri plates | Corning | 351029 | |
| MATLAB | Mathworks | http://www.mathworks.com/products/matlab/ | |
| Oligonucleotide primers | Integrated DNA Technologies | https://www.idtdna.com/pages/products/dna-rna/custom-dna-oligos | 25 nmol scale, standard desalting |
| pBR322_AvrII | available upon request | pBR322 plasmid modified to contain AvrII restriction site downstream of the TEM-1 gene | |
| pBR322_OP1 – pBR322_OP5 | available upon request | five modified pBR322 plasmids each containing a pair of orthogonal priming sites | |
| Q5 high-fidelity DNA polymerase | New England Biolabs | M0491L | includes 5X PCR buffer and PCR additive (GC enhancer) |
| 15 mL conical tube | Corning | 430025 | |
| Multichannel pipettes (Eppendorf ResearchPlus) | Eppendorf | ||
| PCR plate, 96 well | Fisher Scientific | 14230232 | |
| 96 well plate seal | Excel Scientific | F-96-100 | |
| Veriti 96-well thermal cycler | Applied Biosystems | 4375786 | |
| 6X gel loading dye | New England Biolabs | B7024S | |
| Agarose | Research Products Intl. Corp. | 20090-500.0 | |
| Ethidium bromide | Bio-Rad | 161-0433 | |
| UV transilluminator (FOTO/Analyst ImageTech) | Fotodyne Inc. | http://www.fotodyne.com/content/ImageTech_gel_documentation | |
| EB buffer | Qiagen | 19086 | |
| 96-well black-walled, clear bottom assay plates | Corning | 3651 | |
| Lambda phage DNA | New England Biolabs | N3011S | |
| PicoGreen dsDNA reagent | Invitrogen | P7581 | dsDNA quantitation reagent, used in protocol step 2.2.4 |
| Victor 3V microplate reader | PerkinElmer | ||
| DNA purification kit | Zymo Research | D4003 | |
| Microcentrifuge tubes | Corning | 3621 | |
| Long-wavelength UV illuminator | Fisher Scientific | FBUVLS-80 | |
| Agarose gel DNA extraction buffer | Zymo Research | D4001-1-100 | |
| AatII | New England Biolabs | R0117S | |
| AvrII | New England Biolabs | R0174L | |
| T4 DNA ligase | New England Biolabs | M0202S | |
| EVB100 electrocompetent E. coli | Avidity | EVB100 | |
| Electroporator (E. coli Pulser) | Bio-Rad | 1652102 | |
| Electroporation cuvettes | Bio-Rad | 165-2089 | |
| Spectrophotometer (Ultrospec 3100 pro) | Amersham Biosciences | 80211237 | |
| 50 mL conical tubes | Corning | 430828 | |
| Plasmid purification kit | Macherey-Nagel | 740588.25 | |
| 8 well PCR strip tubes | Axygen | 321-10-551 | |
| Qubit dsDNA HS assay kit | Invitrogen | Q32854 | dsDNA quantitation reagent |
| Qubit assay tubes | Invitrogen | Q32856 | |
| Qubit fluorometer | Invitrogen | Q32866 | |
| Ampicillin sodium salt | Akron Biotechnology | 50824296 | |
| MiSeq reagent kit v2 (500 cycles) | Illumina | MS-102-2003 | |
| MiSeq desktop sequencer | Illumina | http://www.illumina.com/systems/miseq.html | alternatively, one could sequence on Illumina HiSeq platform |
| FLASh software | John Hopkins University – open source | http://ccb.jhu.edu/software/FLASH/ | software to merge paired-end reads from next-generation sequencing data |
| AatII_F | GATAATAATGGTTTCTTAGACGTCAGGTGGC | ||
| AvrII_R | CTTCACCTAGGTCCTTTTAAATTAAAAATGAAG | ||
| AvrII_F | CTTCATTTTTAATTTAAAAGGACCTAGGTGAAG | ||
| AatII_OP1_R | ACCTGACGTCCGTATTTCAACTGTCCGGTCTAAGAAACCATTATTATCATGACATTAAC | ||
| AatII_OP2_R | ACCTGACGTCCGCTCACGGAGTGTACTAATTAAGAAACCATTATTATCATGACATTAAC | ||
| AatII_OP3_R | ACCTGACGTCGTACGTCTGAACTTGGGACTTAAGAAACCATTATTATCATGACATTAAC | ||
| AatII_OP4_R | ACCTGACGTCCCGTTCTCGATACCAAGTGATAAGAAACCATTATTATCATGACATTAAC | ||
| AatII_OP5_R | ACCTGACGTCGTCCGTCGGAGTAACAATCTTAAGAAACCATTATTATCATGACATTAAC | ||
| OP1_F | GACCGGACAGTTGAAATACG | ||
| OP1_R | CGACGTACAGGACAATTTCC | ||
| OP2_F | ATTAGTACACTCCGTGAGCG | ||
| OP2_R | AGTATTAGGCGTCAAGGTCC | ||
| OP3_F | AGTCCCAAGTTCAGACGTAC | ||
| OP3_R | GAAAAGTCCCAATGAGTGCC | ||
| OP4_F | TCACTTGGTATCGAGAACGG | ||
| OP4_R | TATCACGGAAGGACTCAACG | ||
| OP5_F | AGATTGTTACTCCGACGGAC | ||
| OP5_R | TATAACAGGCTGCTGAGACC | ||
| Group1_F | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNGCATTTTGCCTACCGGTTTTTGC | ||
| Group1_R | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTCTTGCCCGGCGTCAAC | ||
| Group2_F | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNGAACGTTTTCCAATGATGAGCAC | ||
| Group2_R | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNGTCCTCCGATCGTTGTCAGAAG | ||
| Group3_F | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNAGTAAGAGAATTATGCAGTGCTGCC | ||
| Group3_R | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTCGCCAGTTAATAGTTTGCGC | ||
| Group4_F | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNCCAAACGACGAGCGTGACAC | ||
| Group4_R | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNGCAATGATACCGCGAGACCC | ||
| Group5_F | ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNCGGCTGGCTGGTTTATTGC | ||
| Group5_R | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNTATATGAGTAAACTTGGTCTGACAG | ||
| 501_F | AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGAC | ||
| 502_F | AATGATACGGCGACCACCGAGATCTACACATAGAGGCACACTCTTTCCCTACACGAC | ||
| 503_F | AATGATACGGCGACCACCGAGATCTACACCCTATCCTACACTCTTTCCCTACACGAC | ||
| 504_F | AATGATACGGCGACCACCGAGATCTACACGGCTCTGAACACTCTTTCCCTACACGAC | ||
| 505_F | AATGATACGGCGACCACCGAGATCTACACAGGCGAAGACACTCTTTCCCTACACGAC | ||
| 701_R | CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTG | ||
| 702_R | CAAGCAGAAGACGGCATACGAGATTCTCCGGAGTGACTGGAGTTCAGACGTG |
References
- Hutchison, C. A., et al. Mutagenesis at a specific position in a DNA sequence. J Biol Chem. 253 (18), 6551-6560 (1978).
- Mullis, K. B., Faloona, F. A. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 155, 335-350 (1987).
- Papworth, C., Bauer, J. C., Braman, J., Wright, D. A. Site-directed mutagenesis in one day with >80% efficiency. Strategies. 9 (3), 3-4 (1996).
- Higuchi, R., Krummel, B., Saiki, R. K. A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic Acids Res. 16 (15), 7351-7367 (1988).
- Rennell, D., Bouvier, S. E., Hardy, L. W., Poteete, A. R. Systematic mutation of bacteriophage T4 lysozyme. J Mol Biol. 222 (1), 67-88 (1991).
- Markiewicz, P., Kleina, L. G., Cruz, C., Ehret, S., Miller, J. H. Genetic studies of the lac repressor. XIV. Analysis of 4000 altered Escherichia coli lac repressors reveals essential and non-essential residues, as well as ‘spacers’ which do not require a specific sequence. J Mol Biol. 240 (5), 421-433 (1994).
- Kleina, L. G., Miller, J. H. Genetic studies of the lac repressor. XIII. Extensive amino acid replacements generated by the use of natural and synthetic nonsense suppressors. J Mol Biol. 212 (2), 295-318 (1990).
- Huang, W., Petrosino, J., Hirsch, M., Shenkin, P. S., Palzkill, T. Amino acid sequence determinants of beta-lactamase structure and activity. J Mol Biol. 258 (4), 688-703 (1996).
- Fowler, D. M., et al. High-resolution mapping of protein sequence-function relationships. Nat Methods. 7 (9), 741-746 (2010).
- Hietpas, R. T., Jensen, J. D., Bolon, D. N. Experimental illumination of a fitness landscape. Proc Natl Acad Sci U S A. 108 (19), 7896-7901 (2011).
- McLaughlin, R. N., Poelwijk, F. J., Raman, A., Gosal, W. S., Ranganathan, R. The spatial architecture of protein function and adaptation. Nature. 491 (7422), 138-142 (2012).
- Deng, Z., et al. Deep sequencing of systematic combinatorial libraries reveals beta-lactamase sequence constraints at high resolution. J Mol Biol. 424 (3-4), 150-167 (2012).
- Stiffler, M. A., Hekstra, D. R., Ranganathan, R. Evolvability as a Function of Purifying Selection in TEM-1 beta-Lactamase. Cell. 160 (5), 882-892 (2015).
- Matagne, A., Lamotte-Brasseur, J., Frere, J. M. Catalytic properties of class A beta-lactamases: efficiency and diversity. Biochem J. 330 (Pt2), 581-598 (1998).
- Salverda, M. L., De Visser, J. A., Barlow, M. Natural evolution of TEM-1 beta-lactamase: experimental reconstruction and clinical relevance. FEMS Microbiol Rev. 34 (6), 1015-1036 (2010).
- Weinreich, D. M., Delaney, N. F., Depristo, M. A., Hartl, D. L. Darwinian evolution can follow only very few mutational paths to fitter proteins. Science. 312 (5770), 111-114 (2006).
- Stewart, S. M., Fisher, M., Young, J. E., Lutz, W. Ampicillin levels in sputum, serum, and saliva. Thorax. 25 (3), 304-311 (1970).
- Giachetto, G., et al. Ampicillin and penicillin concentration in serum and pleural fluid of hospitalized children with community-acquired pneumonia. Pediatr Infect Dis J. 23 (7), 625-629 (2004).
- Ambler, R. P., et al. A standard numbering scheme for the class A beta-lactamases. Biochem J. 276 (Pt 1), 269-270 (1991).
- Magoc, T., Salzberg, S. L. FLASH: fast length adjustment of short reads to improve genome assemblies). Bioinformatics. 27 (21), 2957-2963 (2011).
- Melamed, D., Young, D. L., Gamble, C. E., Miller, C. R., Fields, S. Deep mutational scanning of an RRM domain of the Saccharomyces cerevisiae poly(A)-binding protein. RNA. 19 (11), 1537-1551 (2013).
- Bank, C., Hietpas, R. T., Jensen, J. D., Bolon, D. N. A systematic survey of an intragenic epistatic landscape. Mol Biol Evol. 32 (1), 229-238 (2015).
- Dove, S. L., Joung, J. K., Hochschild, A. Activation of prokaryotic transcription through arbitrary protein-protein contacts. Nature. 386 (6625), 627-630 (1997).
- Romero, P. A., Tran, T. M., Abate, A. R. Dissecting enzyme function with microfluidic-based deep mutational scanning. Proc Natl Acad Sci U S A. 112 (23), 7159-7164 (2015).
