يوضح هذا البروتوكول كيفية توليد أورام نسيلي ملحوظ fluorescently، الذي يعرف وراثيا في ذبابة الفاكهة أقراص تخيلي antennal (EAD) العين /. فهو يصف كيفية تشريح EAD والدماغ من يرقات العمر الثالث وكيفية معالجتها لتصور وتحديد التغييرات التعبير الجيني وغزو الورم.
Drosophila melanogaster has emerged as a powerful experimental system for functional and mechanistic studies of tumor development and progression in the context of a whole organism. Sophisticated techniques to generate genetic mosaics facilitate induction of visually marked, genetically defined clones surrounded by normal tissue. The clones can be analyzed through diverse molecular, cellular and omics approaches. This study describes how to generate fluorescently labeled clonal tumors of varying malignancy in the eye/antennal imaginal discs (EAD) of Drosophila larvae using the Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. It describes procedures how to recover the mosaic EAD and brain from the larvae and how to process them for simultaneous imaging of fluorescent transgenic reporters and antibody staining. To facilitate molecular characterization of the mosaic tissue, we describe a protocol for isolation of total RNA from the EAD. The dissection procedure is suitable to recover EAD and brains from any larval stage. The fixation and staining protocol for imaginal discs works with a number of transgenic reporters and antibodies that recognize Drosophila proteins. The protocol for RNA isolation can be applied to various larval organs, whole larvae, and adult flies. Total RNA can be used for profiling of gene expression changes using candidate or genome-wide approaches. Finally, we detail a method for quantifying invasiveness of the clonal tumors. Although this method has limited use, its underlying concept is broadly applicable to other quantitative studies where cognitive bias must be avoided.
ويمثل سرطان واحدة من أكثر المجموعات غير المتجانسة وراثيا من الأمراض، التي يتزايد بشكل كبير، وخاصة بين كبار السن في جميع أنحاء العالم حدوث وفيات. السرطان ينشأ متطابق بسلالة من خلية بدء الورم الذي يهرب آليات القامع الورم الكامن ويقسم خارج نطاق السيطرة. تراكم تدريجي من الآفات الوراثية التي تعزز تعاوني النمو والانتشار والحركة في حين تمنع الموت والتمايز يحول فرط حميدة الأولي إلى ورم خبيث للغاية، المنتشر والقاتل. أصبح من الواضح أنه بالإضافة إلى تغيرات جينية، تطور الورم يتطلب تغييرات في سدى المحيطة بها، والحديث المتبادل بين أنواع الأورام ومتعددة الخلية (على سبيل المثال، الخلايا الليفية، الخلايا المناعية والبطانية) في المكروية لها. فهم مبادئ الجزيئية الكامنة وراء التحول السرطاني بما في ذلك التفاعلات ورم سدى له أهمية كبيرة لتطوير الحيلولة دوناستراتيجيات نشوئها والفحص المبكر، فضلا عن علاجات جديدة وفعالة لمكافحة ورم خبيث من السرطان ومقاومة المخدرات.
أصبح ذبابة الفاكهة ذبابة الفاكهة نظام جذابة لأبحاث السرطان 1-4 بسبب الوقت جيل سريع لها، والحفاظ على ملحوظا من الإشارات العقد بين الذباب والبشر، والتكرار الجيني المحدود وثروة من الأدوات الجينية المتقدمة التي تسهل التلاعب في الجينات أي تقريبا في بطريقة مقيدة مؤقتا ومكانيا. الأورام محددة وراثيا متفاوتة خبيثة يمكن هندستها بتكاثر في ذبابة الفاكهة عن طريق إدخال gain- والطفرات الخسارة من وظيفة في مجموعة فرعية من الأسلاف في الأنسجة نوع خلاف البرية باستخدام تقنية MARCM 5. الأداة MARCM يجمع FLP / FRT (FLP recombinase / FLP الاعتراف الهدف) بوساطة إعادة التركيب الإنقسامية 6 مع FLP التدريجي 7 و GAL4 / UAS (المنبع تنشيط تسلسل) الجين 8 الهدفنظم التعبير 9. مع هذا التعبير أسلوب أي التحوير أساس UAS، بما في ذلك الجين الورمي أو cDNAs بروتين فلوري أو تكرار الحمض النووي مقلوب لإسكات الجينات التي يسببها الرنا المزدوج الجديلة، سوف تقتصر على استنساخ الخلايا التي فقدت موضع الجيني المحدد وكاظمة GAL4 المقرر أن إعادة التركيب (الشكل 1A). بقع نسيلي التي تحمل علامة فلوري الأخضر (GFP) أو البروتينات الفلورية الحمراء (على سبيل المثال، طلب تقديم العروض، عن dsRed، mCherry) يمكن تعقبها بسهولة في جميع أنحاء التنمية، معزولة وتحليلها. الأهم من ذلك، يمكن مقارنة سلوكهم مباشرة إلى الأنسجة المجاورة نوع البرية. وبالتالي، ذات الصلة الأسئلة إلى الخلية آثار المستقلة وغير المستقلة من الآفات الوراثية يمكن دراستها بشكل ملائم. على غرار الثدييات، الحيوانات المستنسخة فقط التي يتم فيها مجتمعة تصبح عدة آفات أنكجنيك خبيث في ذبابة الفاكهة وألخص بصمات الرئيسية لسرطان الثدييات. أنها overproliferate، التهرب من موت الخلايا المبرمج، وحمل الالتهاب، تصبح خالدة وINVAالجديد إنجازا هاما، مما أسفر عن مقتل نهاية المطاف المضيف 10-17.
هنا، نحن تصف بروتوكول لتوليد أورام نسيلي محددة وراثيا في أنسجة العين / antennal والدماغ من يرقات ذبابة الفاكهة باستخدام تقنية MARCM. يعتمد الأسلوب على MARCM الأسهم اختبار الذي يعبر عن FLP recombinase الخميرة تحت سيطرة محسن بلا عيون (eyFLP) 18،19. وبهذه الطريقة، يتم إنشاء الحيوانات المستنسخة GFP المسمى في كل من ظهارة peripodial وعمودية من هيئة البيئة والظهارة العصبية للدماغ طوال المراحل الجنينية واليرقات (الشكل 1A، B والمرجعية 20). الحيوانات المستنسخة يمكن اتباعها بسهولة حتى سن البلوغ كما يطور EAD في العين الكبار، هوائي ورئيس كبسولة في حين أن الظهارة العصبية تثير neuroblasts التي تنتج متباينة الخلايا العصبية الفص البصري.
لتسهيل التوصيف الجزيئي، وظيفية والمظهري واسعة من النسيج الفسيفساء، فإننا ديالكاتب بروتوكول لتشريح EAD والدماغ من يرقات العمر الثالث والخطوط العريضة لكيفية معالجتها لمدة ثلاثة تطبيقات مختلفة: (ط) الكشف عن صحفيين الفلورسنت المعدلة وراثيا والمناعية، (ب) الكمي لغزو الورم و (ج) تحليل يتغير التعبير الجيني باستخدام الكمي في الوقت الحقيقي PCR (QRT-PCR) أو الإنتاجية العالية مرنا تسلسل (مرنا وما يليها) (الشكل 1C).
بروتوكول المناعية يمكن استخدامها لتصور أي بروتين من الفائدة مع الأجسام المضادة المحددة. توفر المعدلة وراثيا للصحفيين النسخي الفلورسنت المعلومات الزمانية المكانية مريحة ودقيقة عن النشاط لمسار الإشارات معين. خلية نسب للصحفيين معين، من ناحية أخرى، تعكس التغييرات النوعية والكمية في أعداد الخلايا داخل الأنسجة الفسيفساء وبين الأورام من التراكيب الوراثية المتميزة. الكمي للسلوك الغازية يسهل المقارنة بين الأورام الخبيثة السرطانية بين النمط الجينيالصورة. وأخيرا، فإن بروتوكول يصف جمع ومعالجة EAD الفسيفساء لعزل الحمض النووي الريبي هو مناسبة للتطبيقات المصب الصغيرة والكبيرة مثل النسخ العكسي تليها QRT-PCR وعلى نطاق الجينوم مرنا وما يليها على التوالي. البيانات النوعية والكمية التي تم الحصول عليها من هذه المقايسات توفر رؤى جديدة في السلوك الاجتماعي للأورام نسيلي. وعلاوة على ذلك، فإنها تنتج أساسا متينا للدراسات وظيفية على دور الجينات الفردية والشبكات الوراثية والمكروية الورم في مراحل مختلفة، وجوانب من تكون الأورام.
تقنيات لتوليد الفسيفساء الوراثية في ذبابة الفاكهة هي من ضمن الأدوات الأكثر تطورا لتحليل والتلاعب وظيفة الجين 33. وقد ثبت أن نظام eyFLP-MARCM قوية وقوية لأنها تتيح للتحريض ملحوظ بصريا، استنساخ محددة وراثيا بطريقة مقيدة مكانيا، أي في الأنسجة حيث محسن بلا ع…
The authors have nothing to disclose.
We thank the Bloomington Stock Center (Bloomington, USA), Dirk Bohmann, Katja Brückner and Istvan Ando for fly stocks, and antibodies. We thank Marek Jindra and Colin Donohoe for comments on the manuscript. This work was supported by the Sofja Kovalevskaja Award to M.U. from the Alexander von Humboldt Foundation and DFG project UH243/1-1 to M.U. from the German Research Foundation.
Agar | Gewürzmühle Brecht, Eggenstein, Germany | 00262-0500 | Fly food recipe: Prepare 20 L fly food with 160 g agar, 360 g yeast, 200 g soy flour, 1.6 kg yellow cornmeal, 1.2 L malt extract, 300 ml light corn syrup, 130 ml propionic acid and 200 ml 15% nipagin. Fly food should be cooked for 1 hour at 85°C. |
Corn syrup | Grafschafter Krautfabrik Josef Schmitz KG, Meckenheim, Germany | 01939 | |
Propionic acid | Carl Roth GmbH, Karlsruhe, Germany | 6026.1 | |
Cornmeal | ReformKontor GmbH, Zarrentin, Germany | 4010155063948 | |
Malt extract | CSM Deutschland GmbH, Bremen, Germany | 728985 | |
Soy flour | Stockmeier Food GmbH, Herford, Germany | 1000246441010 | |
Yeast | Werner Ramspeck GmbH, Schwabach, Germany | 210099K | |
Methyl-4-benzoate/ Nipagin | Sigma-Aldrich, Deisenhofen, Germany | H5501 | Prepare a 15% stock solution with 70% EtOH |
Drosophila fly food vials | Kisker Biotech, Steinfurt, Germany | 789008 | |
Vial plugs | K-TK e.K., Retzstadt, Germany | 1002 | |
Drosophila fly food bottles | Greiner Bio-One, Frickenhausen, Germany | 960177 | |
Bottle plugs | K-TK e.K., Retzstadt, Germany | 1002 S | |
Poly(vinyl alcohol) 4-88/[-CH2CHOH-]n | Sigma-Aldrich, Deisenhofen, Germany | 81381 | Mounting medium recipe: Dissolve 6 g Poly(vinyl alcohol) 4-88 in 39 ml Millipore H2O, 6 ml 1 M Tris (pH 8.5) and 12.5 ml glycerol. Stir overnight at 50°C and centrifuge 20 min at 5000 rpm. Add DABCO to the supernatant to get a final concentration of 2.5%. Store aliquots at -20°C. |
1,4-Diazabicyclo[2.2.2]octane/ DABCO | Sigma-Aldrich, Deisenhofen, Germany | D2522 | |
Triton X-100 | Sigma-Aldrich, Deisenhofen, Germany | 9002-93-1 | |
Phosphate-buffered saline/ PBS | 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 and 1.8 mM KH2PO4, pH 7.4 in Millipore H2O | ||
PBST | 0.1% Triton X-100 in PBS | ||
Paraformaldehyde/ PFA | Sigma-Aldrich, Deisenhofen, Germany | 158127 | 4% PFA fixative recipe: Dissolve 4 g PFA in 80 ml Millipore H2O on a magnetic stirrer plate heated to 55 °C. Add 1M NaOH dropwise until all PFA particles are dissolved. Add 10 ml 10X PBS and adjust the pH to 7.4 with 1M HCl. Mix in 100 µl Triton X-100 and fill up with Millipore H2O to 100 ml. Store aliquots at -20°C. Avoid repeated thawing. (CAUTION: PFA is highly toxic. Prepare the PFA fixative in a fume hood. Wear a self-contained breathing apparatus, gloves and clothing. Avoid contact with skin, eyes or mucous membranes) |
Bovine Serum Albumin/ BSA | Sigma-Aldrich, Deisenhofen, Germany | A3059 | Blocking solution recipe: Dissolve 0.3% BSA in PBST |
4’,6-Diamidino-2-phenylindol Dihydrochlorid/ DAPI | Carl Roth GmbH, Karlsruhe, Germany | 6335 | DAPI staining solution: Prepare a stock solution of 5 mg/ml in Millipore H2O and store aliquots at 4°C. Used in dilution 1:1000 in PBST. |
Alexa Flour 546 Phalloidin | Invitrogen, Karlsruhe, Germany | A22283 | Used in dilution 1:500 in PBST. |
Mouse anti-H2 antibody | Kurucz et al., 2003 | Used in dilution 1:500 in blocking solution | |
Cy5 AffiniPure Donkey Anti-Mouse IgG (H+L) | Jackson ImmunoResearch, Suffolk, UK | 715-175-151 | Used in dilution 1:500 in blocking solution |
Dumont #5 forceps | Fine Science Tools, Heidelberg, Germany | 11295-10 | |
Glass embryo dish (30 mm) | Thermo Scientific, Schwerte, Germany | E90 | |
Tungsten needles | Fine Science Tools, Heidelberg, Germany | 10130-20 | |
Nickel Plated Pin Holder | Fine Science Tools, Heidelberg, Germany | 26018-17 | |
Microscope slides | VWR, Darmstadt, Germany | 631-1553 | |
Coverslips 22 x 22 mm (#1 Menzel-Gläser) | VWR, Darmstadt, Germany | 631-1336 | |
Coverslips 24 x 50 mm (0.13-0.16 mm) | Thermo Scientific, Schwerte, Germany | 1076371 | |
Kimtech Science Precision Wipes | Thermo Scientific, Schwerte, Germany | 06-677-70 | |
Dissecting stereomicroscope | Olympus, Hamburg, Germany | SZX7 (DF PLAPO 1X-4 Japan) | |
Fluorescent stereomicroscope | Olympus, Hamburg, Germany | SZX16 (SDF PLAPO 0.8X Japan) with DP72 CCD camera | Equipped with the narrow blue bandpass filter set for excitation of GFP other blue excitable fluorochromes (excitation filter BP460-480 nm, barrier filter BA495-540 nm) and narrow green excitation and longpass barrier filter for RFP and other green excitable fluorochromes (excitation filter BP530-550, barrier filter BA575IF). Software: Olympus cellSens Standard 1.11. |
Confocal microscope | Olympus, Hamburg, Germany | FV1000 | Equipped with inverted IX81 microscope. Objectives: 20× UPlan S-Apo (NA 0.85), 40× UPlanFL (NA 1.30) and 60× UPlanApo (NA 1.35). Lasers: UV laser Diode LD405 (50mW), Argon laser, multi-line 457/(476)/ 488/515 (40mW), Yellow/Green laser diode LD560 (15mW) and Red Laser diode 635 (20mW). Software: Fluoview 2.1c Software |
Drosophila cooled incubator | Ewald Innovationstechnik GmbH, Bad Nenndorf, Germany | Sanyo MIR553 | |
Squirt bottle | VWR, Darmstadt, Germany | 215-8105 | |
BD Clay Adams Nutator Mixer | VWR, Darmstadt, Germany | 15172-203 | |
ELMI Digital Rocking Shaker | VWR, Darmstadt, Germany | DRS-12 | |
5 PRIME Isol-RNA Lysis Reagent | VWR, Darmstadt, Germany | 2302700 | The protocol is compatible with other TRIzol-based reagents e.g. TRIreagent from Sigma (Cat. Nr.T9424), TRIzol reagent from Thermofisher (Cat. Nr. 15596). |
Diethyl pyrocarbonate/ DEPC | Sigma-Aldrich, Deisenhofen, Germany | D5758 | Dilute DEPC 1:1000 in Millipore H2O, stir overnight and autoclave. |
UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1) | ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany | 15593-031 | |
Chloroform | Merck, Darmstadt, Germany | 102445 | |
TURBO DNase (2 U/µl) | Thermo Scientific, Schwerte, Germany | AM2238 | |
Invitrogen UltraPure Glycogen | ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany | 10-814-010 | |
Sodium acetate trihydrate | VWR, Darmstadt, Germany | 27652.232 | Prepare a 3M Sodium acetate solution with DEPC-H2O and adjust the pH to 5.2 |
2-Propanol | Merck, Darmstadt, Germany | 109634 | |
Ethanol | Merck, Darmstadt, Germany | 100983 | Prepare a 75% EtOH dilution with DEPC-H2O. |
UV/Vis-Spectrophotometre NanoDrop ND-8000 | Thermo Scientific, Schwerte, Germany | ND-8000 | |
Eppendorf Microcentrifuge (Refrigerated) | Thermo Scientific, Schwerte, Germany | 5417R | |
Experion RNA StdSens Analysis Kit | Bio-Rad Laboratories GmbH, München, Germany | 7007103 | |
Experion Automated Electrophoresis Station | Bio-Rad Laboratories GmbH, München, Germany | 7007010 | |
SuperScript III Reverse Transcriptase | Thermo Scientific, Schwerte, Germany | 18080044 | |
Oligo d(T) Primer | Integrated DNA Technologies, Leuven, Belgium | Prepare 100 µM stock solutions in DEPC-H20 and store at -20°C | |
dNTP Mixture | Takara Bio Europe/Clonetech, Saint-Germain-en-Laye, France | 4030 | Store aliquots of 25 µl at -20°C |
CFX96 Touch Real-Time PCR Detection System | Bio-Rad Laboratories GmbH, München, Germany | 1855195 | |
iQ SYBR Green Supermix | Bio-Rad Laboratories GmbH, München, Germany | 170-8882 | |
Hard-Shell PCR Plates 96-well, thin wall | Bio-Rad Laboratories GmbH, München, Germany | HSP9601 | |
Microseal 'B' Film | Bio-Rad Laboratories GmbH, München, Germany | MSB1001 | |
rp49 Forward primer | Integrated DNA Technologies, Leuven, Belgium | 5' TCCTACCAGCTTCAAGATGAC 3' | |
rp49 Reverse primer | Integrated DNA Technologies, Leuven, Belgium | 5' CACGTTGTGCACCAGGAACT 3' | |
mmp1 Forward primer | Integrated DNA Technologies, Leuven, Belgium | 5' AGGGCGACAAGTACTACAAGCTGA 3' | |
mmp1 Reverse primer | Integrated DNA Technologies, Leuven, Belgium | 5' ACGTCTTGCCGTTCTTGTAGGTGA 3' |