<em> Drosophila</em> Имаджинальное Disc Опухоль Модель: Визуализация и Количественная экспрессии генов и опухолевой инвазии с использованием генетических Мозаики
Summary
Этот протокол показывает , как генерировать флуоресцентно помечены, генетически определенные клоновых опухоли в Drosophila глаз / усиков имагинальных дисков (EAD). Он описывает, как препарировать EAD и мозг от личинок третьей возрастной стадии и как обрабатывать их для визуализации и количественной оценки изменений экспрессии генов и опухоли инвазивность.
Abstract
Drosophila melanogaster has emerged as a powerful experimental system for functional and mechanistic studies of tumor development and progression in the context of a whole organism. Sophisticated techniques to generate genetic mosaics facilitate induction of visually marked, genetically defined clones surrounded by normal tissue. The clones can be analyzed through diverse molecular, cellular and omics approaches. This study describes how to generate fluorescently labeled clonal tumors of varying malignancy in the eye/antennal imaginal discs (EAD) of Drosophila larvae using the Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. It describes procedures how to recover the mosaic EAD and brain from the larvae and how to process them for simultaneous imaging of fluorescent transgenic reporters and antibody staining. To facilitate molecular characterization of the mosaic tissue, we describe a protocol for isolation of total RNA from the EAD. The dissection procedure is suitable to recover EAD and brains from any larval stage. The fixation and staining protocol for imaginal discs works with a number of transgenic reporters and antibodies that recognize Drosophila proteins. The protocol for RNA isolation can be applied to various larval organs, whole larvae, and adult flies. Total RNA can be used for profiling of gene expression changes using candidate or genome-wide approaches. Finally, we detail a method for quantifying invasiveness of the clonal tumors. Although this method has limited use, its underlying concept is broadly applicable to other quantitative studies where cognitive bias must be avoided.
Introduction
Рак является одной из наиболее генетически гетерогенная группа заболеваний, чья заболеваемость и смертность резко возрастает, особенно среди пожилых людей во всем мире. Рак берет свое начало от клонированных опухолевой клетки, инициирующие, что ускользает от механизмов супрессии опухолей и присущая разделяющей из-под контроля. Постепенное накопление генетических повреждений, которые совместно способствуют росту, пролиферации и моторику, предотвращая смерть и дифференцировку преобразует исходную доброкачественное разрастание в высоко злокачественную, метастатической и смертельной опухоли. Стало очевидным , что в дополнение к генетических изменений, прогрессирование опухоли требует изменений в окружающей стромы и перекрестных помех между типами опухолей и множественной клеток (например, фибробласты, иммунных и эндотелиальных клеток) в своей микросреде. Понимание молекулярных принципов, лежащих в основе злокачественной трансформации, включая опухоли стромы взаимодействий имеет большое значение для развития предупреждеТион и раннего скрининга стратегии, а также новые и эффективные методы лечения для борьбы с метастазирования рака и лекарственной устойчивости.
Плодовой мушки дрозофилы стала привлекательной системой для исследования рака 1-4 в связи с его быстрым временем поколения, замечательное сохранение сигнальных узлов между мух и людей, ограниченной генетической избыточности и богатства передовых генетических инструментов , которые облегчают манипуляции практически любого гена в временно и пространственно ограниченным способом. Генетически определенные опухоли различной злокачественной опухоли могут быть воспроизводимо инженерии в дрозофилы путем введения амплитудно и с потерей функции мутации в субпопуляции клеток – предшественников в противном случае дикого типа ткани с использованием метода MARCM 5. Инструмент MARCM сочетает в себе ФЛП / FRT (ФЛП рекомбиназа / ФЛП распознавание цели) -опосредованной митотической рекомбинации 6 с FLP-аута 7 и Gal4 / UAS (Upstream активации последовательности) 8 гена – мишенисистемы экспрессии 9. С помощью этого метода экспрессии любого UAS на основе трансгенов, включая онкогена или флуоресцентный белок кДНК или инвертированные повторы ДНК для дцРНК-индуцированной молчанием генов, будет ограничено клон клеток, которые потеряли определенный генетический локус и репрессор Gal4 в результате рекомбинации (Рисунок 1А). Клональный пятна , отмеченные зеленым флуоресцентным (GFP) или красный флуоресцентные белки (например, RFP, DsRed, mCherry) может быть легко отслеживаться на протяжении развития, выделяли и анализировали. Важно отметить, что их поведение может быть непосредственно по сравнению с прилегающей типа ткани дикого. Таким образом, вопросы, имеющие отношение к клетке автономных и неавтономных эффекты генетических поражений могут быть легко изучены. Подобно млекопитающих, только клоны , в которых несколько онкогенных поражений комбинируются становятся злокачественными у дрозофилы и резюмировать основные признаки рака у млекопитающих. Они overproliferate, уйти от апоптоза, вызывают воспаление, становятся бессмертными и InvaSIVE, в конечном счете убивает хозяина 10-17.
Здесь мы опишем протокол для создания генетически определенные клоновых опухоли в глаз / усиков и мозговой ткани личинок дрозофилы с использованием метода MARCM. Метод основан на MARCM тестера запаса, выражающего дрожжи ФЛП рекомбиназу под контролем ушка энхансер (eyFLP) 18,19. Таким образом, GFP-меченные клоны генерируются в обоих peripodial и столбчатым эпителием EAD и нейроэпителии головного мозга на протяжении эмбриональной и личиночной стадии (Фигура 1А, В и ссылочных 20). Клоны можно легко проследить до взрослой жизни, как EAD развивается в взрослых глаз, антенны и головной капсулы в то время как нейроэпителия приводит к нейробластов, которые производят дифференцированные оптические нейроны лепестка.
Для облегчения обширной молекулярной, функциональной и фенотипическую характеристику мозаики ткани, мы деписец протокол для рассечения EAD и головного мозга от личинок третьей возрастной стадии и кратко описано, как обрабатывать их для трех различных применений: (I) обнаружения трансгенных флуоресцентных репортеры и иммунное окрашивание, (II) Количественное инвазивности опухолей и (III), анализ экспрессия гена изменяется с помощью количественного в реальном времени ПЦР (QRT-PCR) или высокой пропускной способностью мРНК последовательности (мРНК-Seq) (рис 1C).
Протокол иммунное может быть использован для визуализации любой белок, представляющий интерес со специфическим антителом. Трансгенные флуоресцентные репортеры транскрипции обеспечивают удобную и точную пространственно-временную информацию о деятельности конкретного сигнального пути. Клеточная линиеспецифический репортеры, с другой стороны, отражают количественные и качественные изменения в клеточных популяций в пределах мозаичного ткани и среди опухолей различных генотипов. Количественное инвазивного поведения облегчает сравнение опухоли злокачественного между генотипомs. И, наконец, протокол, описывающий процесс сбора и обработки мозаики EAD для выделения РНК подходит как для малых и больших масштабах вниз по течению приложений, таких как обратной транскрипции с последующей QRT-PCR и общегеномного мРНК-SEQ соответственно. Качественные и количественные данные, полученные из этих анализов являются новые проникновения в суть социального поведения клоновых опухолей. Кроме того, они создают прочную основу для функциональных исследований о роли отдельных генов, генетических сетей и микросреды опухоли на разных стадиях и аспекты онкогенеза.
Protocol
Representative Results
Discussion
Методы для создания генетических мозаик в дрозофилы являются одними из самых сложных инструментов для анализа и манипулирования функции гена 33. Система eyFLP-MARCM доказала мощные и надежные , поскольку она позволяет индукцию визуально отмеченных, генетически определенных клон…
Divulgations
The authors have nothing to disclose.
Acknowledgements
We thank the Bloomington Stock Center (Bloomington, USA), Dirk Bohmann, Katja Brückner and Istvan Ando for fly stocks, and antibodies. We thank Marek Jindra and Colin Donohoe for comments on the manuscript. This work was supported by the Sofja Kovalevskaja Award to M.U. from the Alexander von Humboldt Foundation and DFG project UH243/1-1 to M.U. from the German Research Foundation.
Materials
| Agar | Gewürzmühle Brecht, Eggenstein, Germany | 00262-0500 | Fly food recipe: Prepare 20 L fly food with 160 g agar, 360 g yeast, 200 g soy flour, 1.6 kg yellow cornmeal, 1.2 L malt extract, 300 ml light corn syrup, 130 ml propionic acid and 200 ml 15% nipagin. Fly food should be cooked for 1 hour at 85°C. |
| Corn syrup | Grafschafter Krautfabrik Josef Schmitz KG, Meckenheim, Germany | 01939 | |
| Propionic acid | Carl Roth GmbH, Karlsruhe, Germany | 6026.1 | |
| Cornmeal | ReformKontor GmbH, Zarrentin, Germany | 4010155063948 | |
| Malt extract | CSM Deutschland GmbH, Bremen, Germany | 728985 | |
| Soy flour | Stockmeier Food GmbH, Herford, Germany | 1000246441010 | |
| Yeast | Werner Ramspeck GmbH, Schwabach, Germany | 210099K | |
| Methyl-4-benzoate/ Nipagin | Sigma-Aldrich, Deisenhofen, Germany | H5501 | Prepare a 15% stock solution with 70% EtOH |
| Drosophila fly food vials | Kisker Biotech, Steinfurt, Germany | 789008 | |
| Vial plugs | K-TK e.K., Retzstadt, Germany | 1002 | |
| Drosophila fly food bottles | Greiner Bio-One, Frickenhausen, Germany | 960177 | |
| Bottle plugs | K-TK e.K., Retzstadt, Germany | 1002 S | |
| Poly(vinyl alcohol) 4-88/[-CH2CHOH-]n | Sigma-Aldrich, Deisenhofen, Germany | 81381 | Mounting medium recipe: Dissolve 6 g Poly(vinyl alcohol) 4-88 in 39 ml Millipore H2O, 6 ml 1 M Tris (pH 8.5) and 12.5 ml glycerol. Stir overnight at 50°C and centrifuge 20 min at 5000 rpm. Add DABCO to the supernatant to get a final concentration of 2.5%. Store aliquots at -20°C. |
| 1,4-Diazabicyclo[2.2.2]octane/ DABCO | Sigma-Aldrich, Deisenhofen, Germany | D2522 | |
| Triton X-100 | Sigma-Aldrich, Deisenhofen, Germany | 9002-93-1 | |
| Phosphate-buffered saline/ PBS | 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 and 1.8 mM KH2PO4, pH 7.4 in Millipore H2O | ||
| PBST | 0.1% Triton X-100 in PBS | ||
| Paraformaldehyde/ PFA | Sigma-Aldrich, Deisenhofen, Germany | 158127 | 4% PFA fixative recipe: Dissolve 4 g PFA in 80 ml Millipore H2O on a magnetic stirrer plate heated to 55 °C. Add 1M NaOH dropwise until all PFA particles are dissolved. Add 10 ml 10X PBS and adjust the pH to 7.4 with 1M HCl. Mix in 100 µl Triton X-100 and fill up with Millipore H2O to 100 ml. Store aliquots at -20°C. Avoid repeated thawing. (CAUTION: PFA is highly toxic. Prepare the PFA fixative in a fume hood. Wear a self-contained breathing apparatus, gloves and clothing. Avoid contact with skin, eyes or mucous membranes) |
| Bovine Serum Albumin/ BSA | Sigma-Aldrich, Deisenhofen, Germany | A3059 | Blocking solution recipe: Dissolve 0.3% BSA in PBST |
| 4’,6-Diamidino-2-phenylindol Dihydrochlorid/ DAPI | Carl Roth GmbH, Karlsruhe, Germany | 6335 | DAPI staining solution: Prepare a stock solution of 5 mg/ml in Millipore H2O and store aliquots at 4°C. Used in dilution 1:1000 in PBST. |
| Alexa Flour 546 Phalloidin | Invitrogen, Karlsruhe, Germany | A22283 | Used in dilution 1:500 in PBST. |
| Mouse anti-H2 antibody | Kurucz et al., 2003 | Used in dilution 1:500 in blocking solution | |
| Cy5 AffiniPure Donkey Anti-Mouse IgG (H+L) | Jackson ImmunoResearch, Suffolk, UK | 715-175-151 | Used in dilution 1:500 in blocking solution |
| Dumont #5 forceps | Fine Science Tools, Heidelberg, Germany | 11295-10 | |
| Glass embryo dish (30 mm) | Thermo Scientific, Schwerte, Germany | E90 | |
| Tungsten needles | Fine Science Tools, Heidelberg, Germany | 10130-20 | |
| Nickel Plated Pin Holder | Fine Science Tools, Heidelberg, Germany | 26018-17 | |
| Microscope slides | VWR, Darmstadt, Germany | 631-1553 | |
| Coverslips 22 x 22 mm (#1 Menzel-Gläser) | VWR, Darmstadt, Germany | 631-1336 | |
| Coverslips 24 x 50 mm (0.13-0.16 mm) | Thermo Scientific, Schwerte, Germany | 1076371 | |
| Kimtech Science Precision Wipes | Thermo Scientific, Schwerte, Germany | 06-677-70 | |
| Dissecting stereomicroscope | Olympus, Hamburg, Germany | SZX7 (DF PLAPO 1X-4 Japan) | |
| Fluorescent stereomicroscope | Olympus, Hamburg, Germany | SZX16 (SDF PLAPO 0.8X Japan) with DP72 CCD camera | Equipped with the narrow blue bandpass filter set for excitation of GFP other blue excitable fluorochromes (excitation filter BP460-480 nm, barrier filter BA495-540 nm) and narrow green excitation and longpass barrier filter for RFP and other green excitable fluorochromes (excitation filter BP530-550, barrier filter BA575IF). Software: Olympus cellSens Standard 1.11. |
| Confocal microscope | Olympus, Hamburg, Germany | FV1000 | Equipped with inverted IX81 microscope. Objectives: 20× UPlan S-Apo (NA 0.85), 40× UPlanFL (NA 1.30) and 60× UPlanApo (NA 1.35). Lasers: UV laser Diode LD405 (50mW), Argon laser, multi-line 457/(476)/ 488/515 (40mW), Yellow/Green laser diode LD560 (15mW) and Red Laser diode 635 (20mW). Software: Fluoview 2.1c Software |
| Drosophila cooled incubator | Ewald Innovationstechnik GmbH, Bad Nenndorf, Germany | Sanyo MIR553 | |
| Squirt bottle | VWR, Darmstadt, Germany | 215-8105 | |
| BD Clay Adams Nutator Mixer | VWR, Darmstadt, Germany | 15172-203 | |
| ELMI Digital Rocking Shaker | VWR, Darmstadt, Germany | DRS-12 | |
| 5 PRIME Isol-RNA Lysis Reagent | VWR, Darmstadt, Germany | 2302700 | The protocol is compatible with other TRIzol-based reagents e.g. TRIreagent from Sigma (Cat. Nr.T9424), TRIzol reagent from Thermofisher (Cat. Nr. 15596). |
| Diethyl pyrocarbonate/ DEPC | Sigma-Aldrich, Deisenhofen, Germany | D5758 | Dilute DEPC 1:1000 in Millipore H2O, stir overnight and autoclave. |
| UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1) | ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany | 15593-031 | |
| Chloroform | Merck, Darmstadt, Germany | 102445 | |
| TURBO DNase (2 U/µl) | Thermo Scientific, Schwerte, Germany | AM2238 | |
| Invitrogen UltraPure Glycogen | ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany | 10-814-010 | |
| Sodium acetate trihydrate | VWR, Darmstadt, Germany | 27652.232 | Prepare a 3M Sodium acetate solution with DEPC-H2O and adjust the pH to 5.2 |
| 2-Propanol | Merck, Darmstadt, Germany | 109634 | |
| Ethanol | Merck, Darmstadt, Germany | 100983 | Prepare a 75% EtOH dilution with DEPC-H2O. |
| UV/Vis-Spectrophotometre NanoDrop ND-8000 | Thermo Scientific, Schwerte, Germany | ND-8000 | |
| Eppendorf Microcentrifuge (Refrigerated) | Thermo Scientific, Schwerte, Germany | 5417R | |
| Experion RNA StdSens Analysis Kit | Bio-Rad Laboratories GmbH, München, Germany | 7007103 | |
| Experion Automated Electrophoresis Station | Bio-Rad Laboratories GmbH, München, Germany | 7007010 | |
| SuperScript III Reverse Transcriptase | Thermo Scientific, Schwerte, Germany | 18080044 | |
| Oligo d(T) Primer | Integrated DNA Technologies, Leuven, Belgium | Prepare 100 µM stock solutions in DEPC-H20 and store at -20°C | |
| dNTP Mixture | Takara Bio Europe/Clonetech, Saint-Germain-en-Laye, France | 4030 | Store aliquots of 25 µl at -20°C |
| CFX96 Touch Real-Time PCR Detection System | Bio-Rad Laboratories GmbH, München, Germany | 1855195 | |
| iQ SYBR Green Supermix | Bio-Rad Laboratories GmbH, München, Germany | 170-8882 | |
| Hard-Shell PCR Plates 96-well, thin wall | Bio-Rad Laboratories GmbH, München, Germany | HSP9601 | |
| Microseal 'B' Film | Bio-Rad Laboratories GmbH, München, Germany | MSB1001 | |
| rp49 Forward primer | Integrated DNA Technologies, Leuven, Belgium | 5' TCCTACCAGCTTCAAGATGAC 3' | |
| rp49 Reverse primer | Integrated DNA Technologies, Leuven, Belgium | 5' CACGTTGTGCACCAGGAACT 3' | |
| mmp1 Forward primer | Integrated DNA Technologies, Leuven, Belgium | 5' AGGGCGACAAGTACTACAAGCTGA 3' | |
| mmp1 Reverse primer | Integrated DNA Technologies, Leuven, Belgium | 5' ACGTCTTGCCGTTCTTGTAGGTGA 3' |
References
- Miles, W. O., Dyson, N. J., Walker, J. A. Modeling tumor invasion and metastasis in Drosophila. Dis Model Mech. 4 (6), 753-761 (2011).
- Stefanatos, R. K. A., Vidal, M. Tumor invasion and metastasis in Drosophila: a bold past, a bright future. J Genet Genomics. 38 (10), 431-438 (2011).
- Patel, P. H., Edgar, B. A. Tissue design: How Drosophila tumors remodel their neighborhood. Semin Cell Dev Biol. 28, 86-95 (2014).
- Gonzalez, C. Drosophila melanogaster: a model and a tool to investigate malignancy and identify new therapeutics. Nat Rev Cancer. 13 (3), 172-183 (2013).
- Lee, T., Luo, L. Mosaic analysis with a repressible cell marker (MARCM) for Drosophila neural development. Trends Neurosci. 24 (5), 251-254 (2001).
- Xu, T., Rubin, G. M. Analysis of genetic mosaics in developing and adult Drosophila tissues. Development. 117 (4), 1223-1237 (1993).
- Struhl, G., Basler, K. Organizing activity of wingless protein in Drosophila. Cell. 72 (4), 527-540 (1993).
- Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118 (2), 401-415 (1993).
- Wu, J. S., Luo, L. A protocol for mosaic analysis with a repressible cell marker (MARCM) in Drosophila. Nat Protoc. 1 (6), 2583-2589 (2006).
- Brumby, A. M., Richardson, H. E. scribble mutants cooperate with oncogenic Ras or Notch to cause neoplastic overgrowth in Drosophila. EMBO J. 22 (21), 5769-5779 (2003).
- Pagliarini, R. A., Xu, T. A genetic screen in Drosophila for metastatic behavior. Science (New York, NY). 302 (5648), 1227-1231 (2003).
- Uhlirova, M., Bohmann, D. JNK- and Fos-regulated Mmp1 expression cooperates with Ras to induce invasive tumors in Drosophila. EMBO J. 25 (22), 5294-5304 (2006).
- Turkel, N., et al. The BTB-zinc finger transcription factor abrupt acts as an epithelial oncogene in Drosophila melanogaster through maintaining a progenitor-like cell state. PLoS Genet. 9 (7), e1003627 (2013).
- Cordero, J. B., et al. Oncogenic Ras Diverts a Host TNF Tumor Suppressor Activity into Tumor Promoter. Dev Cell. 18 (6), 999-1011 (2010).
- Khoo, P., Allan, K., Willoughby, L., Brumby, A. M., Richardson, H. E. In Drosophila, RhoGEF2 cooperates with activated Ras in tumorigenesis through a pathway involving Rho1-Rok-Myosin-II and JNK signalling. Dis Model Mech. 6, 661-678 (2013).
- Jiang, Y., Scott, K. L., Kwak, S. J., Chen, R., Mardon, G. Sds22/PP1 links epithelial integrity and tumor suppression via regulation of myosin II and JNK signaling. Oncogene. 30 (29), 3248-3260 (2011).
- Figueroa-Clarevega, A., Bilder, D. Malignant Drosophila Tumors Interrupt Insulin Signaling to Induce Cachexia-like Wasting. Dev Cell. 33 (1), 47-55 (2015).
- Newsome, T. P., Asling, B., Dickson, B. J. Analysis of Drosophila photoreceptor axon guidance in eye-specific mosaics. Development. 127 (4), 851-860 (2000).
- Quiring, R., Walldorf, U., Kloter, U., Gehring, W. J. Homology of the eyeless gene of Drosophila to the Small eye gene in mice and Aniridia in humans. Science. 265 (5173), 785-789 (1994).
- Külshammer, E., Uhlirova, M. The actin cross-linker Filamin/Cheerio mediates tumor malignancy downstream of JNK signaling. J Cell Sci. 126 (Pt 4), 927-938 (2013).
- North, A. J. Seeing is believing? A beginners’ guide to practical pitfalls in image acquisition. J Cell Biol. 172 (1), 9-18 (2006).
- Waters, J. C. Accuracy and precision in quantitative fluorescence microscopy. J Cell Biol. 185 (7), 1135-1148 (2009).
- Igaki, T., Pagliarini, R. A., Xu, T. Loss of cell polarity drives tumor growth and invasion through JNK activation in Drosophila. Curr Biol. 16 (11), 1139-1146 (2006).
- Külshammer, E., et al. Interplay among Drosophila transcription factors Ets21c, Fos and Ftz-F1 drives JNK-mediated tumor malignancy. Dis Model Mech. 8 (10), 1279-1293 (2015).
- Pastor-Pareja, J. C., Wu, M., Xu, T. An innate immune response of blood cells to tumors and tissue damage in Drosophila. Dis Model Mech. 1 (2-3), 144-154 (2008).
- Chatterjee, N., Bohmann, D. A versatile ΦC31 based reporter system for measuring AP-1 and Nrf2 signaling in Drosophila and in tissue culture. PloS One. 7 (4), e34063 (2012).
- Petraki, S., Alexander, B., Brückner, K. Assaying Blood Cell Populations of the Drosophila melanogaster Larva. J Vis Exp. (105), (2015).
- Makhijani, K., Alexander, B., Tanaka, T., Rulifson, E., Bruckner, K. The peripheral nervous system supports blood cell homing and survival in the Drosophila larva. Development. 138 (24), 5379-5391 (2011).
- Kurucz, E., et al. Hemese, a hemocyte-specific transmembrane protein, affects the cellular immune response in Drosophila. Proc Natl Acad Sci USA. 100 (5), 2622-2627 (2003).
- Andersen, D. S., et al. The Drosophila TNF receptor Grindelwald couples loss of cell polarity and neoplastic growth. Nature. 522 (7557), 482-486 (2015).
- Srivastava, A., Pastor-Pareja, J. C., Igaki, T., Pagliarini, R., Xu, T. Basement membrane remodeling is essential for Drosophila disc eversion and tumor invasion. Proc Natl Acad Sci USA. 104 (8), 2721-2726 (2007).
- Larionov, A., Krause, A., Miller, W. A standard curve based method for relative real time PCR data processing. BMC Bioinformatics. 6 (1), (2005).
- Blair, S. S. Genetic mosaic techniques for studying Drosophila development. Development. 130 (21), 5065-5072 (2003).
- Mirth, C. K., Shingleton, A. W. Integrating body and organ size in Drosophila: recent advances and outstanding problems. Front Endocrinol. 3 (49), (2012).
- French, V., Feast, M., Partridge, L. Body size and cell size in Drosophila: the developmental response to temperature. J Insect Physiol. 44 (11), 1081-1089 (1998).
- Ashburner, M., Bonner, J. J. The induction of gene activity in drosophila by heat shock. Cell. 17 (2), 241-254 (1979).
- Frazier, M. R., Woods, H. A., Harrison, J. F. Interactive effects of rearing temperature and oxygen on the development of Drosophila melanogaster. Physiol Biochem Zool. 74 (5), 641-650 (2001).
- Lai, S. L., Lee, T. Genetic mosaic with dual binary transcriptional systems in Drosophila. Nat Neurosci. 9 (5), 703-709 (2006).
- Potter, C. J., Tasic, B., Russler, E. V., Liang, L., Luo, L. The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis. Cell. 141 (3), 536-548 (2010).
- del Valle Rodrìguez, A., Didiano, D., Desplan, C. Power tools for gene expression and clonal analysis in Drosophila. Nature Methods. 9 (1), 47-55 (2011).
- Rynes, J., et al. Activating Transcription Factor 3 Regulates Immune and Metabolic Homeostasis. Mol Cell Biol. 32 (19), 3949-3962 (2012).
- Claudius, A. K., Romani, P., Lamkemeyer, T., Jindra, M., Uhlirova, M. Unexpected role of the steroid-deficiency protein ecdysoneless in pre-mRNA splicing. PLoS Genet. 10 (4), e1004287 (2014).
- Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of Specific Cell Population by Fluorescence Activated Cell Sorting (FACS). J Vis Exp. (41), (2010).
- Tauc, H. M., Tasdogan, A., Pandur, P. Isolating intestinal stem cells from adult Drosophila midguts by FACS to study stem cell behavior during aging. J Vis Exp. (94), (2014).
