توليف وتوصيف للدواء مساعد الأسبرين-فومرت أن يمنع آخر عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة والثدي خلايا السرطان الجذعية
Summary
This procedure will demonstrate how we synthesized and characterized the anti-NFκB and anti-cancer stem cell activity of an aspirin-fumarate prodrug.
Abstract
التهاب هو السمة المميزة السرطان الذي يكمن وراء الإصابة بالسرطان والترويج، وتقدم في نهاية المطاف إلى ورم خبيث. لذلك، مضيفا عقار مضاد للالتهابات لأفواج السرطان القياسية قد تحسين نتائج المرضى. وقد تم اكتشاف واحدة من هذه المخدرات، والأسبرين (حمض الصفصاف، ASA)، على الوقاية الكيماوية السرطان والنشاط المضادة للورم. وبالاضافة الى تثبيط انزيمات الأكسدة الحلقية محور 2-البروستاجلاندين، وأيضا نسبت الأنشطة المضادة للسرطان ASA على العامل النووي ĸB (NFĸB) تثبيط. بسبب استخدام ASA لفترات طويلة قد يسبب سمية الجهاز الهضمي، وقد تم تنفيذ استراتيجية دواء مساعد بنجاح. في هذا دواء مساعد تصميم ملثمين حمض الكربوكسيلية من ASA وتدرج فارماكوفور إضافي.
يصف هذا البروتوكول كيفية تصنيعه ودواء مساعد الأسبرين فومرت، GTCpFE، وتتميز تثبيطه لمسار NFĸB في خلايا سرطان الثدي وتخفيف من السرطان الجذعية التي تشبه السليمالعلاقات، والنمط الظاهري NFĸB التي تعتمد على المهم. GTCpFE يمنع بشكل فعال مسار NFĸB في خطوط خلايا سرطان الثدي بينما ASA يفتقر إلى أي نشاط كابح، مشيرا إلى أن إضافة فومرت إلى هيكل ASA يساهم إلى حد كبير في نشاطها. وبالإضافة إلى ذلك، GTCpFE يظهر المضادة للسرطان نشاط كبير الخلايا الجذعية عن طريق عرقلة تشكيل mammosphere والتخفيف من الخلايا الجذعية السرطانية المرتبطة CD44 + CD24 – نمط ظاهري مناعي. هذه النتائج تضع استراتيجية قابلة للتطبيق لتطوير وتحسين العقاقير المضادة للالتهابات لالوقاية الكيماوية وعلاج السرطان.
Introduction
التهاب هو السمة المميزة التي ترتكز عليها جوانب متعددة من تكون الأورام، مثل حدوث والترويج، وتقدم في نهاية المطاف إلى ورم خبيث 1. في سرطان الثدي، ويدعم هذا مزيدا من الملاحظات الوبائية تبين أن الاستخدام المنتظم للأسبرين المخدرات الكلاسيكية غير الستيرويدية المضادة للالتهابات (الاسيتيل حمض الصفصاف، ASA) ويرتبط مع انخفاض في كل من حدوث سرطان الثدي، وخطر ورم خبيث وتكرارها 2،3. ASA يعمل في المقام الأول عن طريق تثبيط انزيمات الأكسدة الحلقية 2-النشاط، والتي غالبا ما upregulated في سرطان الثدي 4،5. ومع ذلك، يمكن أيضا بوساطة تأثيرات مضادة للسرطان ASA عن طريق قمع الشاذة العامل النووي كيلوبايت (عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة ) يشير 6-8. هذا أمر مهم لأن مسار عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة حررت يعزز الورم بقاء الخلية، والانتشار، والهجرة، والغزو، الأوعية الدموية، ومقاومة للعلاج 11/09. عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة تفعيل مسار أمر بالغ الأهمية أيضا لتركيب استجابة مناعية. لذلك، لعلاج مضاد للسرطان التي تتطلب فترات طويلة تثبيط عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة، لا بد من النظر في الآثار الجانبية الضارة التي تنطوي طويلة الأمد قمع المناعي. وبالتالي، قد ASA بمثابة نقطة انطلاق جيدة لتعظيم الاستفادة العلاجية.
واحد الحد لتطبيق ASA في علاج السرطان هو جرعات مرتفعة المطلوبة للانزيمات الأكسدة الحلقية 2 وعامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة تثبيط، والتي ترتبط مع سمية الجهاز الهضمي، مثل قرحة المعدة ونزيف 12،13. ومع ذلك، وتحويل ASA إلى دواء مساعد كما استر، قد يقلل من سمية الجهاز الهضمي ASA ل. لتعزيز قوة و / أو إضافة وظائف، ويمكن أيضا أن تدمج العناصر الهيكلية إضافية أو فارماكوفور التبعية في تصميم استر دواء مساعد. وأضاف أحد هؤلاء حامل الخاصة الدوائية لتعزيز ASA قوة ضد مسار عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة هو فومرت، الذي أظهرنا سابقا أن من المهم للعامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة طريق تثبيط 14،15.
<p class="jove_content"> نحن توليفها ودواء مساعد الأسبرين فومرت 15، GTCpFE، وافترض أن هذا الجزيء الهجين سوف يكون آمنا بعد قويا ضد مسار عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة . نحن اختبار النشاط المضادة للعامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة في خلايا سرطان الثدي وقدرته على منع خلايا سرطان الثدي الجذعية (الخلايا الجذعية السرطانية) 15، والتي تعتمد على عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة إشارات من أجل البقاء والنمو 16-21. نجد أن قوة من GTCpFE ضد مسار عامل نووي معزز لسلسلة ضوء كابا في الخلايا البائية النشطة وتحسنت بشكل ملحوظ خلال ASA 15. وبالإضافة إلى ذلك، وكتل GTCpFE تشكيل mammosphere وخفف من ديوان الخدمة المدنية علامة سطح CD44 + CD24 – نمط ظاهري مناعي، مشيرا إلى أن GTCpFE قادر على القضاء على الخلايا الجذعية السرطانية 15. هذه النتائج هي من يضع دواء مساعد الأسبرين فومرت كعامل فعال مضاد للالتهابات التي يمكن أيضا استهداف الخلايا الجذعية السرطانية الثدي. من حيث العلاج سرطان الثدي، قد يكون GTCpFE القدرة على علاج مرض عدوانية وفتكا.Protocol
Representative Results
Discussion
In this protocol, we demonstrated the synthesis of an ASA prodrug, GTCpFE, where the fumarate pharmacophore was incorporated to improve the anti-NFĸB activity in breast cancer cells. GTCpFE is an effective NFĸB inhibitor, whereas ASA itself is not, even at much higher concentrations. The fumarate moiety has anti-inflammatory properties as shown by its ability to inhibit NFĸB signaling in a variety of cell lines and tissues14,25-29. The prodrug strategy described herein, is amendable to other mal…
Divulgations
The authors have nothing to disclose.
Acknowledgements
This work was supported by grants provided by the National Institutes of Health (NIH), R01 CA200669 to JF and R01 CA121107 to GRJT, and by a postdoctoral fellowship grant from Susan G. Komen for the Cure to IK (PDF12229484).
Materials
| RPMI 1640 Red Medium | Life Technologies | 11875-093 | Warm up to 37°C before use |
| IMEM | Corning | 10-024-CV | Warm up to 37°C before use |
| DMEM / F12 Medium | ThermoFisher | 21041-025 | Warm up to 37°C before use |
| MEM NEAA 10mM 100X | Life Technologies | 11140 | |
| Penicillin Streptomycin | Life Technologies | 15140-122 | |
| L-Glutamine 100X | Life Technologies | 25030-081 | |
| Insulin | Sigma-Aldrich | I-1882 | |
| Fetal Bovine Serum | Atlanta Biologicals | S11150 | |
| Trypsin 2.5% 10X | Invitrogen | 15090046 | |
| Methyl Cellulose | Sigma | M0262 | |
| B27 Supplement 50X | Gibco | 17504-044 | |
| EGF | Gibco | PHG0311L | |
| NFκB-RE Luciferase Construct | Clontech | pGL4.32 | |
| Renilla Luciferase Construct | Promega | pGL4.70 | |
| Lipofectamine 2000 | ThermoFisher | 11668-019 | |
| Dual-Luciferase Reporter Assay | Promega | 120000032 | |
| NanoDrop Spectrophotometer | ThermoFisher | ||
| Eppendorf Mastercycler | Eppendorf | ||
| StepOne Real Time PCR System | Thermo Scientific | ||
| Eclipse Microscope | Nikon | ||
| CyAn ADP Analyzer | Beckman Coulter | ||
| QCapture Software | QImaging | ||
| Summit Software | Beckman Coulter | ||
| GraphPad Software | Prism | ||
| TRIzol | ThermoFisher | 15596-018 | |
| M-MLV Reverse Transcriptase | Invitrogen | 28025-013 | |
| 100 mM dNTP Set | Invitrogen | 10297-018 | |
| Random Hexamers | Invitrogen | 48190-011 | |
| Fast SYBR Green Master Mix | ThermoFisher | 4385612 | |
| Costar 96W, ultra low attachment | Corning | 3474 | |
| HBSS, 1X | ThermoFisher | 14025134 | |
| CD44-APC conjugated antibody | BD Pharmingen | 560990 | Store at 4°C, protect from light |
| CD24-PE antibody | BD Pharmingen | 560991 | Store at 4°C, protect from light |
| Recombinant Human TNFα | Fisher | 210TA100 | |
| CCL2 Primer Forward Sequence | AGAATCACCAGCAGCAAGTGTCC | ||
| CCL2 Primer Reverse Sequence | TCCTGAACCCACTTCTGCTTGG | ||
| ICAM1 Primer Reverse Sequence | TGACGAAGCCAGAGGTCTCAG | ||
| ICAM1 Primer Forward Sequence | AGCGTCACCTTGGCTCTAGG | ||
| TNF Primer Forward Sequence | AAGGGTGACCGACTCAGCG | ||
| TNF Primer Reverse Sequence | ATCCCAAAGTAGACCTGCCCA | ||
| 36B4 Primer Forward Sequence | GTGTTCGACAATGGCAGCAT | ||
| 36B4 Primer Reverse Sequence | GACACCCTCCAGGAAGCGA | ||
| Sodium Hydroxide | Sigma-Aldrich | S5881-500G | |
| 4-Hydroxybenzyl Alcohol | Sigma-Aldrich | 20806-10G | |
| O-Acetylsalicyloyl Chloride | Sigma-Aldrich | 165190-5G | |
| Phosphorous Pentoxide | Sigma-Aldrich | 79610-100G | |
| Ethyl Fumaroyl Chloride | Sigma-Aldrich | 669695-1G | |
| Sodium Sulfate | Sigma-Aldrich | 246980-500G | |
| 4-Dimethylaminopyridine | Sigma-Aldrich | 714844-100ML | 0.5 M in tetrahydrofuran |
| Triethylamine | Sigma-Aldrich | T0886-100ML | |
| Toluene | Sigma-Aldrich | 244511-100ML | |
| Ethyl Acetate | Sigma-Aldrich | 270989-100ML | |
| Tetrahydrofuran | Sigma-Aldrich | 401757-2L | |
| 400 MHz FT NMR spectrometer | See Bruker’s Avance User’s Manual, version 000822 for details |
References
- Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, 646-674 (2011).
- Cuzick, J., et al. Aspirin and non-steroidal anti-inflammatory drugs for cancer prevention: an international consensus statement. Lancet Oncol. 10, 501-507 (2009).
- Terry, M. B., et al. Association of frequency and duration of aspirin use and hormone receptor status with breast cancer risk. JAMA. 291, 2433-2440 (2004).
- Wang, D., Dubois, R. N. Cyclooxygenase-2: a potential target in breast cancer. Semin Oncol. 31, 64-73 (2004).
- Howe, L. R. Inflammation and breast cancer. Cyclooxygenase/prostaglandin signaling and breast cancer. Breast Cancer Res. 9. 9, 210 (2007).
- Kopp, E., Ghosh, S. Inhibition of NF-kappa B by sodium salicylate and aspirin. Science. 265, 956-959 (1994).
- Yin, M. J., Yamamoto, Y., Gaynor, R. B. The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta. Nature. 396, 77-80 (1998).
- Pierce, J. W., Read, M. A., Ding, H., Luscinskas, F. W., Collins, T. Salicylates inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration. J Immunol. 156, 3961-3969 (1996).
- Frasor, J., El-Shennawy, L., Stender, J. D., Kastrati, I. NFkappaB affects estrogen receptor expression and activity in breast cancer through multiple mechanisms. Mol Cell Endocrinol. 418, 235-239 (2014).
- Perkins, N. D. The diverse and complex roles of NF-kappaB subunits in cancer. Nat Rev Cancer. 12, 121-132 (2012).
- DiDonato, J. A., Mercurio, F., Karin, M. NF-kappaB and the link between inflammation and cancer. Immunol Rev. 246, 379-400 (2012).
- Scarpignato, C., Hunt, R. H. Nonsteroidal antiinflammatory drug-related injury to the gastrointestinal tract: clinical picture, pathogenesis, and prevention. Gastroenterol Clin North Am. 39, 433-464 (2010).
- Sostres, C., Gargallo, C. J. Gastrointestinal lesions and complications of low-dose aspirin in the gastrointestinal tract. Best Pract Res Clin Gastroenterol. 26, 141-151 (2012).
- Kastrati, I., et al. Dimethyl Fumarate Inhibits the Nuclear Factor kappaB Pathway in Breast Cancer Cells by Covalent Modification of p65 Protein. J Biol Chem. 291, 3639-3647 (2016).
- Kastrati, I., et al. A novel aspirin prodrug inhibits NFkappaB activity and breast cancer stem cell properties. BMC Cancer. 15, 845 (2015).
- Cao, Y., Luo, J. L., Karin, M. IkappaB kinase alpha kinase activity is required for self-renewal of ErbB2/Her2-transformed mammary tumor-initiating cells. Proc Natl Acad Sci U S A. 104, 15852-15857 (2007).
- Liu, M., et al. The canonical NF-kappaB pathway governs mammary tumorigenesis in transgenic mice and tumor stem cell expansion. Cancer Res. 70, 10464-10473 (2010).
- Korkaya, H., Liu, S., Wicha, M. S. Regulation of cancer stem cells by cytokine networks: attacking cancer’s inflammatory roots. Clin Cancer Res. 17, 6125-6129 (2011).
- Hinohara, K., et al. ErbB receptor tyrosine kinase/NF-kappaB signaling controls mammosphere formation in human breast cancer. Proc Natl Acad Sci U S A. 109, 6584-6589 (2012).
- Kendellen, M. F., Bradford, J. W., Lawrence, C. L., Clark, K. S., Baldwin, A. S. Canonical and non-canonical NF-kappaB signaling promotes breast cancer tumor-initiating cells. Oncogene. 33, 1297-1305 (2014).
- Yamamoto, M., et al. NF-kappaB non-cell-autonomously regulates cancer stem cell populations in the basal-like breast cancer subtype. Nat Commun. 4, 2299 (2013).
- Rio, D. C., Ares, M., Hannon, G. J., Nilsen, T. W. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc. , (2010).
- Frasor, J., et al. Positive cross-talk between estrogen receptor and NF-kappaB in breast cancer. Cancer Res. 69, 8918-8925 (2009).
- Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J., Clarke, M. F. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A. 100, 3983-3988 (2003).
- Vandermeeren, M., et al. Dimethylfumarate is an inhibitor of cytokine-induced nuclear translocation of NF-kappa B1, but not RelA in normal human dermal fibroblast cells. J Invest Dermatol. 116, 124-130 (2001).
- Loewe, R., et al. Dimethylfumarate inhibits TNF-induced nuclear entry of NF-kappa B/p65 in human endothelial cells. J Immunol. 168, 4781-4787 (2002).
- Seidel, P., et al. Dimethylfumarate inhibits NF-{kappa}B function at multiple levels to limit airway smooth muscle cell cytokine secretion. Am J Physiol Lung Cell Mol Physiol. 297, L326-L339 (2009).
- Wilms, H., et al. Dimethylfumarate inhibits microglial and astrocytic inflammation by suppressing the synthesis of nitric oxide, IL-1beta, TNF-alpha and IL-6 in an in-vitro model of brain inflammation. J Neuroinflammation. 7, 30 (2010).
- Peng, H., et al. Dimethyl fumarate inhibits dendritic cell maturation via nuclear factor kappaB (NF-kappaB) and extracellular signal-regulated kinase 1 and 2 (ERK1/2) and mitogen stress-activated kinase 1 (MSK1) signaling. J Biol Chem. 287, 28017-28026 (2012).
- Li, H. J., Reinhardt, F., Herschman, H. R., Weinberg, R. A. Cancer-stimulated mesenchymal stem cells create a carcinoma stem cell niche via prostaglandin E2 signaling. Cancer Discov. 2, 840-855 (2012).
- Li, X., et al. Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy. J Natl Cancer Inst. 100, 672-679 (2008).
- Diehn, M., et al. Association of reactive oxygen species levels and radioresistance in cancer stem cells. Nature. 458, 780-783 (2009).
- Hollier, B. G., Evans, K., Mani, S. A. The epithelial-to-mesenchymal transition and cancer stem cells: a coalition against cancer therapies. J Mammary Gland Biol Neoplasia. 14, 29-43 (2009).
- Velasco-Velazquez, M. A., Popov, V. M., Lisanti, M. P., Pestell, R. G. The role of breast cancer stem cells in metastasis and therapeutic implications. Am J Pathol. 179, 2-11 (2011).
- Dontu, G., et al. In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells. Genes Dev. 17, 1253-1270 (2003).
- Charafe-Jauffret, E., et al. Cancer stem cells in breast: current opinion and future challenges. Pathobiology. 75, 75-84 (2008).
- Clayton, H., Titley, I., Vivanco, M. Growth and differentiation of progenitor/stem cells derived from the human mammary gland. Exp Cell Res. 297, 444-460 (2004).
- Ginestier, C., et al. ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell. 1, 555-567 (2007).
- Rosen, J. M., Jordan, C. T. The increasing complexity of the cancer stem cell paradigm. Science. 324, 1670-1673 (2009).
- Visvader, J. E., Lindeman, G. J. Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat Rev Cancer. 8, 755-768 (2008).
