एक जीन नॉकआउट का परिचय सीधे Trypanosoma cruzi के Amastigote चरण में CRISPR/Cas9 प्रणाली का उपयोग
Summary
यहाँ, हम एक प्रोटोकॉल का वर्णन करने के लिए Trypanosoma cruzi के extracellular amastigote में एक जीन नॉकआउट परिचय, CRISPR / विकास phenotype या तो axenic amastigote संस्कृति की सेल गिनती द्वारा या मेजबान सेल आक्रमण के बाद intracellular amastigotes के प्रसार के द्वारा पीछा किया जा सकता है.
Abstract
ट्रिपैनोसोमा क्रूजी एक रोगजनक प्रोटोज़ोअन परजीवी है जो मुख्य रूप से लैटिन अमेरिका में चागास रोग का कारण बनता है। टी Cruziके खिलाफ एक उपन्यास दवा लक्ष्य की पहचान करने के लिए, यह परजीवी के स्तनधारी चरण में लक्ष्य जीन की अनिवार्यता को मान्य करने के लिए महत्वपूर्ण है, amastigote. टी Cruzi के Amastigotes मेजबान सेल के अंदर दोहराने; इस प्रकार, यह अन्य विकासात्मक चरणों के माध्यम से जाने के बिना एक नॉकआउट प्रयोग का संचालन करने के लिए मुश्किल है। हाल ही में, हमारे समूह में एक विकास की स्थिति है जिसमें amastigote अप करने के लिए अपने amastigote की तरह गुणों को खोने के बिना 10 दिनों के लिए axenically दोहराने कर सकते हैं की सूचना दी. इस लौकिक अक्षीय amastigote संस्कृति का उपयोग करके, हम सफलतापूर्वक जीन knockouts कारण और amastigote चरण में विशेष रूप से उनके phenotypes का विश्लेषण करने के लिए Cas9-expressing amastigote में सीधे GRNAs शुरू की. इस रिपोर्ट में, हम एक विस्तृत प्रोटोकॉल का वर्णन करने के लिए इन विट्रो व्युत्पन्न extracellular amastigotes में उत्पादन, और एक CRISPR/Cas9-मध्यस्थ नॉकआउट प्रयोग में axenic संस्कृति का उपयोग करने के लिए. नॉकआउट amastigotes के विकास phenotype या तो कुल्हाड़ी संस्कृति के सेल मायने रखता है द्वारा मूल्यांकन किया जा सकता है, या मेजबान सेल आक्रमण के बाद intracellular amastigote की प्रतिकृति द्वारा. इस विधि परजीवी चरण भेदभाव सामान्य रूप से एक ट्रांसजेनिक या एक नॉकआउट amastigote उत्पादन में शामिल नजरअंदाज कर दिया। अस्थायी अक्षीय अमास्टिगोटसंस्कृति का उपयोग टी क्रुजी में चरण-विशिष्ट अध्ययनों की प्रयोगात्मक स्वतंत्रता का विस्तार करने की क्षमता है।
Introduction
Trypanosoma cruzi Chagas रोग है, जो मुख्य रूप से लैटिन अमेरिका1में प्रचलित है का कारक एजेंट है. टी क्रुजी की विशिष्ट जीवन चक्र अवस्थाहोती है क्योंकि यह कीट सदिश और स्तनधारी मेजबान2के बीच यात्रा करती है . टी Cruzi एक रक्त चूसने triatomine बग के midgut में एक epimastigote के रूप में प्रतिकृति और एक संक्रामक मेटासाइक्लिक trypomastigote में एक मानव या पशु मेजबान पर जमा किया जा रहा से पहले अपने हिंदगुट में differentiates. एक बार trypomastigote काटने साइट के माध्यम से या एक श्लेष्म झिल्ली के माध्यम से मेजबान शरीर में हो जाता है, परजीवी एक मेजबान सेल पर आक्रमण और एक flagella-कम दौर फार्म में बदल एक amastigote कहा जाता है. amastigote मेजबान सेल के भीतर प्रतिकृति और अंत में trypomastigote में differentiates, जो मेजबान सेल से बाहर फट और एक और मेजबान सेल को संक्रमित करने के लिए रक्त प्रवाह में प्रवेश करती है.
वर्तमान में उपलब्ध रसायन चिकित्सा एजेंटों, बेंजनिडाज़ोल और nifurtimox के बाद से, प्रतिकूल दुष्प्रभाव का कारण है और रोगकेपुराने चरण में अप्रभावी हैं 3, यह टी cruzi के खिलाफ उपन्यास दवा लक्ष्यों की पहचान करने के लिए एक महान ब्याज की है। हाल के वर्षों में, CRISPR/Cas9 प्रणाली प्रभावी ढंग से टी Cruziमें जीन नॉकआउट प्रदर्शन करने के लिए एक शक्तिशाली उपकरण बन गया है, या तो अलग या एकल प्लाज्मिड (एस) के transfection द्वारा gRNA और Cas94युक्त , Cas9 की स्थिर अभिव्यक्ति और बाद में GRNA5,6,7 या लिप्यंतर टेम्पलेट का परिचय gRNA8, या पूर्व गठित GRNA/Cas9 RNP परिसर7,9के इलेक्ट्रोपोट्रेशन द्वारा . इस तकनीकी प्रगति उच्च Chagas रोग में दवा लक्ष्य अनुसंधान में तेजी लाने के लिए प्रत्याशित है.
दवा के विकास के साथ आगे बढ़ने के लिए, यह टी Cruziके amastigote में दवा उम्मीदवार यौगिकों के लक्ष्य जीन या प्रभावकारिता की अनिवार्यता को मान्य करने के लिए महत्वपूर्ण है, क्योंकि यह स्तनधारी मेजबान में परजीवी की प्रतिकृति चरण है. हालांकि, यह एक चुनौतीपूर्ण काम है, क्योंकि amastigotes सीधे एक अवरोधक मेजबान सेल की उपस्थिति के कारण हेरफेर नहीं किया जा सकता है. लीशमैनियामें , टी क्रुजीके निकट से संबंधित प्रोटोजोअन परजीवी , एक अक्षीय अमास्टिगोटे पुलिंग विधि विकसित की गई थी और इसका उपयोग औषध जांच परख10,11,12में किया गया है, 13. यद्यपि अक्षीय अमास्टिगोट्स और इंट्रासेल्यूलर एमैस्टिगोट्स14के बीच यौगिकों के प्रति संवेदनशीलता में कुछ विसंगतियां हैं , फिर भी अक्षीय संस्कृति को बनाए रखने की क्षमता का अध्ययन करने के लिए मूल्यवान प्रयोगात्मक उपकरण प्रदान करता है लेशमैनिया15,16के नैदानिक रूप से प्रासंगिक अवस्था के बुनियादी जीव विज्ञान . टी cruziके मामले में , स्वाभाविक रूप से होने वाली extracellular amastigotes (EA)17 की उपस्थिति के बारे में साहित्य और ईए17,18,19 तारीख वापस करने के लिए इन विट्रो उत्पादन में दशकों पहले. इसके अलावा, ईए एक संक्रामक क्षमता है करने के लिए जाना जाता है20,हालांकि trypomastigote की तुलना में कम है, और amastigote मेजबान आक्रमण के तंत्र हाल के वर्षों में स्पष्ट किया गया है (Bonfim-Melo एट अल द्वारा की समीक्षा की.21). हालांकि, Leishmaniaके विपरीत, ईए टी cruziमें एक प्रयोगात्मक उपकरण के रूप में उपयोग नहीं किया गया था, मुख्य रूप से क्योंकि ईए एक अनिवार्य intracellular परजीवी के रूप में माना गया था, और इस तरह के रूप में नहीं माना गया था “प्रतिज्ञेय रूप” एक व्यावहारिक में भावना.
हाल ही में, हमारे समूह के लिए एक अस्थायी अक्षीय संस्कृति 22 के रूप में टी cruzi के ईए का उपयोग करने का प्रस्ताव22. टी Cruzi Tulahuen तनाव के Amastigotes बड़ी गिरावट या amastigote की तरह गुणों के नुकसान के बिना 10 दिनों के लिए 37 डिग्री सेल्सियस पर LIT माध्यम में मेजबान कोशिकाओं से मुक्त प्रतिकृति कर सकते हैं. मेजबान मुक्त विकास अवधि के दौरान, ईए सफलतापूर्वक पारंपरिक इलेक्ट्रोपोट्रेशन द्वारा exogenous जीन अभिव्यक्ति के लिए उपयोग किया गया था, trypanocidal यौगिकों के साथ दवा अनुमापन परख, और CRISPR/Cas9-मध्यस्थ नॉकआउट विकास phenotype निगरानी के बाद. इस रिपोर्ट में, हम विस्तृत प्रोटोकॉल का वर्णन करने के लिए इन विट्रो व्युत्पन्न ईए में उत्पादन और नॉकआउट प्रयोगों में axenic amastigote का उपयोग करें.
Protocol
Representative Results
Discussion
हमने दिखा दिया है कि टी Cruzi amastigotes की axnic संस्कृति CRISPR/Cas9-मध्यस्थ जीन नॉकआउट में उपयोग किया जा सकता है, gRNA सीधे Cas9-expressing EA में electroporating द्वारा. इस तरह, विशेष रूप से amastigote चरण में लक्ष्य जीन की अनिवार्यता अन्य विकासात्?…
Divulgations
The authors have nothing to disclose.
Acknowledgements
यह कार्य जेएसपीएस काकेनही अनुदान संख्या 18K15141 को वाई.टी.
Materials
| 20% formalin solution | FUJIFILM Wako Pure Chemical | 068-03863 | fixing cells |
| 25 cm2 double seal cap culture flask | AGC Techno Glass | 3100-025 | |
| 75 cm2 double seal cap culture flask | AGC Techno Glass | 3110-075 | |
| All-in One Fluorescence Microscope | Keyence | BZ-X710 | |
| Alt-R CRISPR-Cas9 crRNA (for Control) | IDT | custom made | target sequence = GGACGGCACCTTCATCTACAAGG |
| Alt-R CRISPR-Cas9 crRNA (for TcCGM1) | IDT | custom made | target sequence = TAGCCGCGATGGAGAGTTTATGG |
| Alt-R CRISPR-Cas9 crRNA (for TcPAR1) | IDT | custom made | target sequence = CGTGGAGAACGCCATTGCCACGG |
| Alt-R CRISPR-Cas9 tracrRNA | IDT | 1072532 | to anneal with crRNA |
| Amaxa Nucleofector device | LONZA | AAN-1001 | electroporation |
| Basic Parasite Nucleofector Kit 2 | LONZA | VMI-1021 | electroporation |
| BSA | Sigma-Aldrich | A3294 | component of the medium for in-vitro amastigogenesis |
| Burker-Turk disposable hemocytometer | Watson | 177-212C | cell counting |
| Coster 12-well Clear TC-Treated Multiple Well Plates | Corning | 3513 | |
| DMEM | FUJIFILM Wako Pure Chemical | 044-29765 | culture medium |
| Fetal bovine serum, Defined | Hyclone | SH30070.03 | heat-inactivate before use |
| G-418 Sulfate Solution | FUJIFILM Wako Pure Chemical | 077-06433 | selection of transformant |
| Hemin chloride | Sigma-Aldrich | H-5533 | component of LIT medium |
| Hoechst 33342 | Thermo Fisher Scientific | H3570 | staining of nuclei |
| Liver infusion broth, Difco | Becton Dickinson | 226920 | component of LIT medium |
| MES | FUJIFILM Wako Pure Chemical | 349-01623 | component of the medium for in-vitro amastigogenesis |
| PBS (–) | FUJIFILM Wako Pure Chemical | 166-23555 | |
| Propidium Iodide | Sigma-Aldrich | P4864-10ML | staining of dead cells |
| RPMI 1646 | Sigma-Aldrich | R8758 | medium for metacyclogenesis |
References
- World Health Organization. . (WHO) Fact sheet: Chagas disease (American trypanosomiasis). , (2017).
- Clayton, J. Chagas disease 101. Nature. 465 (n7301_supp), S4-S5 (2010).
- Apt, W. Current and developing therapeutic agents in the treatment of Chagas disease. Drug Design, Development and Therapy. 4, 243-253 (2010).
- Lander, N., Li, Z. H. H., Niyogi, S., Docampo, R. CRISPR/Cas9-induced disruption of paraflagellar rod protein 1 and 2 genes in Trypanosoma cruzi reveals their role in flagellar attachment. mBio. 6 (4), e01012 (2015).
- Peng, D., Kurup, S. P., Yao, P. Y., Minning, T. A., Tarleton, R. L. CRISPR-Cas9-mediated single-gene and gene family disruption in Trypanosoma cruzi. mBio. 6 (1), e02097-e02114 (2015).
- Romagnoli, B. A. A., Picchi, G. F. A., Hiraiwa, P. M., Borges, B. S., Alves, L. R., Goldenberg, S. Improvements in the CRISPR/Cas9 system for high efficiency gene disruption in Trypanosoma cruzi. Acta Tropica. 178, 190-195 (2018).
- Burle-Caldas, G. A., Soares-Simões, M., Lemos-Pechnicki, L., DaRocha, W. D., Teixeira, S. M. R. Assessment of two CRISPR-Cas9 genome editing protocols for rapid generation of Trypanosoma cruzi gene knockout mutants. International Journal for Parasitology. 48 (8), 591-596 (2018).
- Costa, F. C. Expanding the toolbox for Trypanosoma cruzi: A parasite line incorporating a bioluminescence-fluorescence dual reporter and streamlined CRISPR/Cas9 functionality for rapid in vivo localisation and phenotyping. PLoS Neglected Tropical Diseases. 12 (4), e0006388 (2018).
- Soares Medeiros, L. C. High-Efficiency Genome Editing in Protozoan Parasites Using CRISPR-Cas9 Ribonucleoproteins. mBio. 8 (6), (2017).
- Callahan, H. L., Portal, A. C., Devereaux, R., Grogl, M. An axenic amastigote system for drug screening. Antimicrobial Agents and Chemotherapy. 41 (4), 818-822 (1997).
- Bates, P. A. Axenic culture of Leishmania amastigotes. Parasitology Today. 9 (4), 143-146 (1993).
- Ravinder, R., Bhaskar, B., Gangwar, S., Goyal, N. Development of luciferase expressing Leishmania donovani axenic amastigotes as primary model for in vitro screening of antileishmanial compounds. Current Microbiology. 65 (6), 696-700 (2012).
- Nühs, A. Development and Validation of a Novel Leishmania donovani Screening Cascade for High-Throughput Screening Using a Novel Axenic Assay with High Predictivity of Leishmanicidal Intracellular Activity. PLoS Neglected Tropical Diseases. 9 (9), 1-17 (2015).
- De Rycker, M. Comparison of a high-throughput high-content intracellular Leishmania donovani assay with an axenic amastigote assay. Antimicrobial Agents and Chemotherapy. 57 (7), 2913-2922 (2013).
- Rochette, A., Raymond, F., Corbeil, J., Ouellette, M., Papadopoulou, B. Whole-genome comparative RNA expression profiling of axenic and intracellular amastigote forms of Leishmania infantum. Molecular and Biochemical Parasitology. 165 (1), 32-47 (2009).
- Pescher, P., Blisnick, T., Bastin, P., Späth, G. F. Quantitative proteome profiling informs on phenotypic traits that adapt Leishmania donovani for axenic and intracellular proliferation. Cellular Microbiology. 13 (7), 978-991 (2011).
- Andrews, N. W., Hong, K. S. U., Robbins, E. S., Nussenzweig, V. Stage-specific surface antigens expressed during the morphogenesis of vertebrate forms of Trypanosoma cruzi. Experimental Parasitology. 64 (3), 474-484 (1987).
- Pan, S. C. Trypanosoma cruzi: intracellular stages grown in a cell-free medium at 37 C. Experimental Parasitology. 45 (2), 215-224 (1978).
- Tomlinson, S., Vandekerckhove, F., Frevert, U., Nussenzweig, V. The induction of Trypanosoma cruzi trypomastigote to amastigote transformation by low pH. Parasitology. 110 (05), 547 (1995).
- Ley, V., Andrews, N. W., Robbins, E. S., Nussenzweig, V. Amastigotes of Trypanosoma cruzi sustain an infective cycle in mammalian cells. Journal of Experimental Medicine. 168 (0022-1007 (Print)), 649-659 (1988).
- Bonfim-Melo, A., Ferreira, E. R., Florentino, P. T. V., Mortara, R. A. Amastigote Synapse: The Tricks of Trypanosoma cruzi Extracellular Amastigotes. Frontiers in Microbiology. 9, 1341 (2018).
- Takagi, Y., Akutsu, Y., Doi, M., Furukawa, K. Utilization of proliferable extracellular amastigotes for transient gene expression, drug sensitivity assay, and CRISPR/Cas9-mediated gene knockout in Trypanosoma cruzi. PLOS Neglected Tropical Diseases. 13 (1), e0007088 (2019).
- Fernandes, J. F., Castellani, O. Growth characteristics and chemical composition of Trypanosoma cruzi. Experimental Parasitology. 18 (2), 195-202 (1966).
- Oberholzer, M., Lopez, M. A., Ralston, K. S., Hill, K. L. Approaches for Functional Analysis of Flagellar Proteins in African Trypanosomes. Methods in Cell Biology. 93, 21-57 (2009).
- van den Hoff, M. J. B., Moorman, A. F. M., Lamers, W. H. Electroporation in ‘intracellular’ buffer increases cell survival. Nucleic Acids Research. 20 (11), 2902-2902 (1992).
- Pacheco-Lugo, L., Díaz-Olmos, Y., Sáenz-García, J., Probst, C. M., DaRocha, W. D. Effective gene delivery to Trypanosoma cruzi epimastigotes through nucleofection. Parasitology International. 66 (3), 236-239 (2017).
- Coughlin, B. C., Teixeira, S. M., Kirchhoff, L. V., Donelson, J. E. Amastin mRNA abundance in Trypanosoma cruzi is controlled by a 3’-untranslated region position-dependent cis-element and an untranslated region-binding protein. The Journal of Biological Chemistry. 275 (16), 12051-1260 (2000).
- Shaw, A. K., Kalem, M. C., Zimmer, S. L. Mitochondrial Gene Expression Is Responsive to Starvation Stress and Developmental Transition in Trypanosoma cruzi. mSphere. 1 (2), (2016).
- Chao, D., Dusanic, D. G. Comparative studies of the isolation of metacyclic trypomastigotes of Trypanosoma cruzi by DEAE ion exchange chromatography. Zhonghua Minguo wei sheng wu ji mian yi xue za zhi (Chinese Journal of Microbiology and Immunology). 17 (3), 146-152 (1984).
- Nogueira, N., Bianco, C., Cohn, Z. Studies on the selective lysis and purification of Trypanosoma cruzi. The Journal of Experimental Medicine. 142 (1), 224-229 (1975).
- Minning, T. A., Weatherly, D. B., Atwood, J., Orlando, R., Tarleton, R. L., Tarleton, R. L. The steady-state transcriptome of the four major life-cycle stages of Trypanosoma cruzi. BMC Genomics. 10, 370 (2009).
- Rico, E., Jeacock, L., Kovářová, J., Horn, D. Inducible high-efficiency CRISPR-Cas9-targeted gene editing and precision base editing in African trypanosomes. Scientific Reports. 8 (1), 7960 (2018).
- Fu, Y. High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nature Biotechnology. 31 (9), 822-826 (2013).
- Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Research. 24 (6), 1012-1019 (2014).
- Chiurillo, M. A., Lander, N., Bertolini, M. S., Storey, M., Vercesi, A. E., Docampo, R. Different roles of mitochondrial calcium uniporter complex subunits in growth and infectivity of Trypanosoma cruzi. mBio. 8 (3), e00574-e00617 (2017).
