Het isoleren van bruine adipocyten uit murine interscapulair bruin vetweefsel voor gen- en eiwitexpressieanalyse
Summary
Deze studie beschrijft een nieuwe methode voor het isoleren van muizenbruine adipocyten voor gen- en eiwitexpressieanalyse.
Abstract
Bruin vetweefsel (BAT) is verantwoordelijk voor niet-rillende thermogenese bij zoogdieren en bruine adipocyten (BA’s) zijn de functionele eenheden van BAT. BA’s bevatten zowel multiloculaire lipidedruppeltjes als overvloedige mitochondriën, en ze drukken ontkoppelend eiwit 1 (UCP1) uit. BA’s worden gecategoriseerd in twee subtypen op basis van hun oorsprong: embryo-afgeleide klassieke BA’s (cBA’s) en witte adipocyten afgeleide BA’s. Vanwege hun relatief lage dichtheid kunnen BA’s niet worden geïsoleerd van BBT met de traditionele centrifugatiemethode. In deze studie werd een nieuwe methode ontwikkeld om BA’s van muizen te isoleren voor gen- en eiwitexpressieanalyse. In dit protocol werd interscapulair BBT van volwassen muizen verteerd met Collagenase en Dispase-oplossing en werden de gedissocieerde BA’s verrijkt met 6% iodixanoloplossing. Geïsoleerde BA’s werden vervolgens gelyseerd met Trizol-reagens voor gelijktijdige isolatie van RNA, DNA en eiwit. Na RNA-isolatie werd de organische fase van het lysaat gebruikt voor eiwitextractie. Onze gegevens toonden aan dat 6% iodixanol-oplossing BA’s efficiënt verrijkte zonder te interfereren met follow-up gen- en eiwitexpressiestudies. Bloedplaatjes-afgeleide groeifactor (PDGF) is een groeifactor die de groei en proliferatie van mesenchymale cellen reguleert. In vergelijking met het bruine vetweefsel hadden geïsoleerde BA’s een significant hogere expressie van Pdgfa. Samenvattend biedt deze nieuwe methode een platform voor het bestuderen van de biologie van bruine adipocyten op een niveau van één celtype.
Introduction
Zowel muizen als mensen hebben twee soorten vetweefsel: wit vetweefsel (WAT) en bruin vetweefsel (BAT)1. WAT slaat energie op in de vorm van triglyceriden in witte adipocyten en de bruine adipocyten (BA’s) van BAT dissiperen chemische energie als warmte2. Op basis van hun ontwikkelingsoorsprong worden BA’s verder onderverdeeld in klassieke BA’s (cBA’s) die zijn gevormd tijdens de ontwikkeling van embryo’s en witte adipocyten afgeleide BA’s (beige / brite-cellen, omgezet uit witte adipocyten onder stressomstandigheden)3. BA’s zijn multiloculair en drukken het thermogene eiwit ontkoppelingseiwit 1 (UCP1)4 uit. Interscapulair BBT (iBAT) depot is een van de primaire cBA’s depots bij kleine zoogdieren5, terwijl beige cellen verspreid zijn binnen WAT6.
Vanwege hun aard van het afvoeren van energie, hebben BA’s veel aandacht gekregen als een therapeutisch doelwit voor het verminderen van obesitas7. Om BA’s te exploiteren voor de behandeling van obesitas, is het essentieel om de moleculaire mechanismen te begrijpen die de functie, overleving en rekrutering van BA’s beheersen. Vetweefsels, waaronder BAT en WAT, zijn heterogeen. Met uitzondering van adipocyten bevatten vetweefsels vele andere celtypen, zoals endotheelcellen, mesenchymale stamcellen en macrofagen8. Hoewel er genetische hulpmiddelen beschikbaar zijn om specifiek kandidaatgenen in muizen BA’s uit te putten, zoals UCP1::Cre-lijn9, zijn technieken voor het zuiveren van BA’s uit BAT of WAT beperkt, waardoor het moeilijk is om BA’s op een eencellig type niveau te bestuderen. Bovendien zal de relatie tussen BA’s en niet-BA’s niet duidelijk worden afgebakend zonder het verkrijgen van zuivere BA’s. Bloedplaatjes-afgeleide groeifactorreceptor alfa (PDGFRα) is bijvoorbeeld gebruikt als marker voor ongedifferentieerde mesenchymale cellen en wordt uitgedrukt in de endotheel- en interstitiële cellen van BAT. In koud gestresste BBT geven PDGFRα-positieve voorlopercellen aanleiding tot nieuwe BA’s10. PDGFRα wordt geactiveerd door zijn ligand PDGF, een groeifactor die de groei en proliferatie van mesenchymale cellen reguleert11; het is echter onduidelijk of BA’s het gedrag van PDGFRα-positieve voorlopercellen beïnvloeden door PDGF uit te scheiden.
Onlangs is een BAs-isolatieprotocol gepubliceerd, dat is gebaseerd op fluorescentie-geactiveerde celsortering (FACS)12. In dit protocol werd 3% runderserumalbumine (BSA) -oplossing gebruikt om BA’s van niet-BA’s te scheiden, en de verrijkte BA’s werden verder gezuiverd door FACS. De toepassing van dit protocol wordt beperkt door de vereiste van het FACS-proces, dat afhankelijk is van zowel apparatuur als FACS-bedieningservaringen. In deze studie werd een nieuw protocol ontwikkeld voor het isoleren van BA’s van BBT. De BA’s die door dit protocol worden geïsoleerd, kunnen direct worden gebruikt voor gen- en eiwitexpressiestudies. Bovendien suggereren gegevens uit deze studie dat BA’s een belangrijke PDGF-bron zijn.
Protocol
Representative Results
Discussion
In deze studie werd een nieuwe methode ontwikkeld voor het isoleren van BA’s voor gen- en eiwitexpressieanalyse.
In een gepubliceerd BA-isolatieprotocol werd 3% BSA-oplossing gebruikt om BA’s12 te verrijken. Niettemin konden de verrijkte BA’s die door dit gepubliceerde protocol werden bereikt, niet direct worden gebruikt voor eiwitexpressieanalyse. Dit komt omdat de geconcentreerde BSA die in de BA-oplossing aanwezig is, interfereert met de daaropvolgende eiwitextractie…
Divulgations
The authors have nothing to disclose.
Acknowledgements
Z. Lin werd ondersteund door national institutes of health HL138454-01 en masonic medical research institute fondsen.
Materials
| Antibodies | |||
| Antigen | Company | Catalog | |
| PPARγ | LSBio | Ls-C368478 | |
| PDGFRa | Santa Cruz | sc-398206 | |
| UCP1 | R&D system | IC6158P | |
| Chemical and solutions | |||
| Collagenase, Type II | Thermo Fisher Scientific | 17101015 | |
| 1-Bromo-3-chloropropane | Sigma-Aldrich | B62404 | |
| Bovine Serum Albumin (BSA) | Goldbio | A-421-10 | |
| Calcium chloride | Bio Basic | CT1330 | |
| Chloroform | IBI Scientific | IB05040 | |
| Dispase II, protease | Sigma-Aldrich | D5693 | |
| EDTA | Bio Basic | EB0107 | |
| Ethanol | IBI Scientific | IB15724 | |
| LiQuant Universal Green qPCR Master Mix | LifeSct | LS01131905Y | |
| Magnesium Chloride Hexahydrate | Boston BioProducts | P-855 | |
| OneScrip Plus cDNA Synthesis SuperMix | ABM | G454 | |
| OptiPrep (Iodixanol) | Cosmo Bio USA | AXS-1114542 | |
| PBS (10x) | Caisson Labs | PBL07 | |
| PBS (1x) | Caisson Labs | PBL06 | |
| Pierce BCA Protein Assay Kit | Thermo Fisher Scientific | 23227 | |
| Potassium Chloride | Boston BioProducts | P-1435 | |
| SimplyBlue safe Stain | Invitrogen | LC6060 | |
| Sodium dodecyl sulfate (SDS) | Sigma-Aldrich | 75746 | |
| Trizol reagent | Life technoologies | 15596018 | |
| Primers | |||
| Gene name (Species) | Forward | Reverse | |
| Pdgfra (Mouse) | CTCAGCTGTCTCCTCACAgG | CAACGCATCTCAGAGAAAAGG | |
| Pdgfa (Mouse) | TGTGCCCATTCGCAGGAAGAG | TTGGCCACCTTGACACTGCG | |
| 36B4(Mouse) | TGCTGAACATCTCCCCCTTCTC | TCTCCACAGACAATGCCAGGAC | |
| Ucp1 | ACTGCCACACCTCCAGTCATT | CTTTGCCTCACTCAGGATTGG | |
| Equipment | |||
| Name | Company | Application | |
| Keyence BZ-X700 | Keyence | Imaging brown adipocytes | |
| Magnetic stirrer | VWR | Dissociate BAT | |
| QuantStudio 6 Flex Real-Time PCR System | Applied Biosystem | Quantitative PCR | |
| The Odyssey Fc Imaging system | LI-COR | Western blot immaging | |
References
- Zwick, R. K., Guerrero-Juarez, C. F., Horsley, V., Plikus, M. V. Anatomical, physiological, and functional diversity of adipose tissue. Cell Metabolism. 27, 68-83 (2018).
- Symonds, M. E. Brown adipose tissue growth and development. Scientifica. 2013, 305763 (2013).
- Giralt, M., Villarroya, F. White, brown, beige/brite: Different adipose cells for different functions. Endocrinology. 154, 2992-3000 (2013).
- Cannon, B., Nedergaard, J. Brown adipose tissue: function and physiological significance. Physiological Reviews. 84, 277-359 (2004).
- Cinti, S. The adipose organ. Prostaglandins, Leukotrienes and Essential Fatty Acids. 73, 9-15 (2005).
- Wu, J., et al. Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human. Cell. 150, 366-376 (2012).
- Cypess, A. M., Kahn, C. R. Brown fat as a therapy for obesity and diabetes. Current Opinion in Endocrinology, Diabetes and Obesity. 17, 143-149 (2010).
- Schoettl, T., Fischer, I. P., Ussar, S. Heterogeneity of adipose tissue in development and metabolic function. Journal of Experimental Biology. 221, (2018).
- Kong, X., et al. IRF4 is a key thermogenic transcriptional partner of PGC-1α. Cell. 158, 69-83 (2014).
- Lee, Y. H., Petkova, A. P., Konkar, A. A., Granneman, J. G. Cellular origins of cold-induced brown adipocytes in adult mice. The FASEB Journal. 29, 286-299 (2015).
- Kim, W. -. S., Park, H. -. S., Sung, J. -. H. The pivotal role of PDGF and its receptor isoforms in adipose-derived stem cells. Histology and Histopathology. 30 (7), 793-799 (2015).
- Hagberg, C. E. Flow cytometry of mouse and human adipocytes for the analysis of browning and cellular heterogeneity. Cell Report. 24, 2746-2756 (2018).
- Madisen, L., et al. A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Nature Neuroscience. 13, 133-140 (2010).
- Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical biochemistry. 150, 76-85 (1985).
- Chey, S., Claus, C., Liebert, U. G. Improved method for simultaneous isolation of proteins and nucleic acids. Analytical Biochemistry. 411, 164-166 (2011).
- Ford, T., Graham, J., Rickwood, D. Iodixanol: A nonionic iso-osmotic centrifugation medium for the formation of self-generated gradients. Analytical Biochemistry. 220, 360-366 (1994).
- Kovacovicova, K., Vinciguerra, M. Isolation of senescent cells by iodixanol (OptiPrep) density gradient-based separation. Cell Proliferation. 52, 12674 (2019).
- Lock, M., et al. versatile manufacturing of recombinant adeno-associated viral vectors at scale. Human Gene Therapy. 21, 1259-1271 (2010).
- Marin, R. D., Crespo-Garcia, S., Wilson, A. M., Sapieha, P. RELi protocol: Optimization for protein extraction from white, brown, and beige adipose tissues. MethodsX. 6, 918-928 (2019).
- Sonna, L. A., Fujita, J., Gaffin, S. L., Lilly, C. M. Invited Review: effects of heat and cold stress on mammalian gene expression. Journal of Applied Physiology. 92, 1725-1742 (2002).
- Gensch, N., Borchardt, T., Schneider, A., Riethmacher, D., Braun, T. Different autonomous myogenic cell populations revealed by ablation of Myf5-expressing cells during mouse embryogenesis. Development. 135, 1597-1604 (2008).
