Summary

Medición directa de las fuerzas dentro de haces de microtúbulos activos reconstituidos

Published: May 10, 2022
doi:

Summary

Aquí, presentamos un protocolo para reconstituir haces de microtúbulos in vitro y cuantificar directamente las fuerzas ejercidas dentro de ellos utilizando trampeo óptico simultáneo y microscopía de fluorescencia de reflexión interna total. Este ensayo permite la medición a nivel nanométrico de las fuerzas y desplazamientos generados por los conjuntos de proteínas dentro de las redes de microtúbulos activos.

Abstract

Las redes de microtúbulos se emplean en las células para realizar una amplia gama de tareas, que van desde actuar como pistas para el transporte de vesículas hasta trabajar como matrices especializadas durante la mitosis para regular la segregación cromosómica. Las proteínas que interactúan con los microtúbulos incluyen motores como las quinesinas y la dineína, que pueden generar fuerzas activas y movimiento direccional, así como proteínas no motoras que entrecruzan filamentos en redes de orden superior o regulan la dinámica del filamento. Hasta la fecha, los estudios biofísicos de las proteínas asociadas a microtúbulos se han centrado abrumadoramente en el papel de las proteínas motoras individuales necesarias para el transporte de vesículas, y se ha logrado un progreso significativo en la elucidación de las propiedades generadoras de fuerza y la regulación mecanoquímica de las quinesinas y las dineínas. Sin embargo, para los procesos en los que los microtúbulos actúan como carga y pista, como durante el deslizamiento del filamento dentro del huso mitótico, se entiende mucho menos sobre la regulación biofísica de los conjuntos de las proteínas de reticulación involucradas. Aquí, detallamos nuestra metodología para sondear directamente la generación de fuerza y la respuesta dentro de redes mínimas de microtúbulos reticulados reconstituidas a partir de microtúbulos purificados y proteínas mitóticas. Los pares de microtúbulos están entrecruzados por proteínas de interés, un microtúbulo se inmoviliza a un cubreobjetos de microscopio y el segundo microtúbulo es manipulado por una trampa óptica. La microscopía de fluorescencia de reflexión interna total simultánea permite la visualización multicanal de todos los componentes de esta red de microtúbulos a medida que los filamentos se separan para generar fuerza. También demostramos cómo estas técnicas se pueden utilizar para sondear las fuerzas de empuje ejercidas por los conjuntos de quinesina-5 y cómo surgen fuerzas de frenado viscosas entre pares de microtúbulos deslizantes reticulados por el MAP mitótico PRC1. Estos ensayos proporcionan información sobre los mecanismos de ensamblaje y función del huso y pueden adaptarse más ampliamente para estudiar la mecánica de la red de microtúbulos densos en diversos contextos, como el axón y las dendritas de las neuronas y las células epiteliales polares.

Introduction

Las células emplean redes de microtúbulos para realizar una amplia variedad de tareas mecánicas, que van desde el transporte de vesículas 1,2,3 hasta la segregación cromosómica durante la mitosis 4,5,6. Muchas de las proteínas que interactúan con los microtúbulos, como las proteínas motoras moleculares quinesina y dineína, generan fuerzas y están reguladas por cargas mecánicas. Para comprender mejor cómo funcionan estas moléculas críticas, los investigadores han empleado métodos biofísicos de una sola molécula, como la captura óptica y la microscopía TIRF, para monitorear directamente parámetros críticos como las tasas de paso descargadas, la procesividad y las relaciones fuerza-velocidad para proteínas individuales. La geometría experimental más utilizada ha sido unir proteínas motoras directamente a las perlas de captura cuya geometría esférica y tamaño imitan vesículas sometidas a transporte motorizado. Numerosas quinesinas, incluyendo kinesina-1 7,8,9, kinesina-2 10,11,12, kinesina-3 13,14,15,16 kinesina-517,18, kinesina-8 19,20, así como complejos de dineína y dineína21,22, 23,24,25, han sido estudiados con estos métodos.

En muchos procesos celulares, sin embargo, las proteínas motoras y no motoras utilizan microtúbulos como pista y carga26,27. Además, en estos escenarios donde los filamentos de microtúbulos están entrecruzados en haces de orden superior, estas proteínas funcionan como conjuntos en lugar de unidades individuales. Por ejemplo, dentro de las células somáticas en división, las redes de filamentos densos se autoorganizan para construir el aparato del huso mitótico28,29,30. La red de microtúbulos del huso interpolar es altamente dinámica y está dispuesta en gran medida con extremos negativos apuntando hacia los polos del huso y extremos más que se superponen cerca del ecuador del huso. Los filamentos dentro del huso están reticulados por proteínas motoras como kinesina-5 31,32,33, quinesina-12 34,35,36 y kinesina-1437,38,39, o por proteínas no motoras como PRC1 40,41,42,43 o NuMA 44,45, 46. Con frecuencia se mueven o experimentan estrés mecánico durante procesos como el flujo hacia los polos o al coordinar el centrado cromosómico durante la metafase o la segregación cromosómica durante la anafase 47,48,49,50,51,52. La integridad del aparato del huso a escala micrométrica a través de la mitosis, por lo tanto, se basa en un equilibrio cuidadosamente regulado de las fuerzas de empuje y tracción generadas y sostenidas por esta red de filamentos que interactúan. Sin embargo, las herramientas necesarias para investigar esta regulación mecánica y explicar cómo los conjuntos de proteínas funcionan en concierto para coordinar los movimientos de los microtúbulos y producir las fuerzas necesarias para ensamblar adecuadamente el huso se han desarrollado recientemente, y apenas estamos empezando a comprender las reglas biofísicas que definen las redes dinámicas de microtúbulos.

El objetivo de este manuscrito es demostrar los pasos necesarios para reconstituir pares de microtúbulos reticulados in vitro, inmovilizar estos haces en una cámara de microscopía que permita la visualización simultánea de fluorescencia tanto de los microtúbulos como de las proteínas de reticulación y la medición de la fuerza a nanoescala, y procesar estos datos de manera robusta. Detallamos los pasos necesarios para polimerizar de manera estable los microtúbulos marcados con fluorescencia, preparar cubreobjetos de microscopio para su fijación, preparar perlas de poliestireno para experimentos de captura óptica y ensamblar redes de filamentos reticulados que preservan su funcionalidad in vivo al tiempo que permiten la manipulación biofísica directa.

Protocol

1. Preparación de microtúbulos NOTA: Cuando se emplean proteínas de reticulación marcadas con GFP, rojas (por ejemplo, rodamina) y rojas lejanas (por ejemplo, HiLyte647 biotiniladas, denominadas rojo lejano biotinilado en el resto del texto) el etiquetado de fluoróforos orgánicos de los microtúbulos funciona bien. Se puede lograr una diafonía mínima entre los tres canales durante la obtención de imágenes mediante el uso de un filtro de fluorescencia de reflexión inte…

Representative Results

La preparación de haces de microtúbulos adecuados para el análisis biofísico se considera exitosa si se cumplen varios de los criterios clave. Primero, las imágenes en tres colores deben revelar dos microtúbulos alineados con una concentración de proteína de reticulación que decora preferentemente la región de superposición (Figura 5B, C y Figura 6B). Idealmente, la distancia entre el borde de superposición y el extr…

Discussion

Las redes de microtúbulos son empleadas por innumerables tipos de células para realizar una amplia gama de tareas que son fundamentalmente de naturaleza mecánica. Para describir cómo funcionan las células tanto en estados sanos como en estados de enfermedad, es fundamental comprender cómo estas redes a escala micrométrica están organizadas y reguladas por las proteínas de tamaño nanométrico que las construyen colectivamente. Las herramientas biofísicas, como las pinzas ópticas, son muy adecuadas para sondear…

Divulgations

The authors have nothing to disclose.

Acknowledgements

Los autores desean agradecer el apoyo de R21 AG067436 (a JP y SF), T32 AG057464 (a ET) y Rensselaer Polytechnic Institute School of Science Startup Funds (a SF).

Materials

10W Ytterbium Fiber Laser, 1064nm IPG Photonics YLR-10-1064-LP
405/488/561/640nm Laser Quad Band Set for TIRF applications Chroma TRF89901v2
6x His Tag Antibody, Biotin Conjugate Invitrogen #MA1-21315-BTIN
Acetone, HPLC grade Fisher Scientific 18-608-395
Alpha casein from bovine milk Sigma 1002484390
ATP Fisher Scientific BP413-25
Benzonase Novagen 70746-3
Biotin-PEG-SVA-5000 Laysan Bio, Inc. NC0479433
BL21 (DE3) Rosetta Cells Millipore Sigma 71-400-3
Catalase MP Biomedicals LLC 190311
CFI Apo 100X/1.49NA oil immersion TIRF objective Nikon N/A
Chloramphenicol ACROS Organics 227920250
Coverslip Mini-Rack, for 8 coverslips Fisher Scientific C14784
Delicate Task Wipers Kimberly-Clark 34120
Dextrose Anhydrous Fisher Scientific BP3501
D-Sucrose Fisher Scientific BP220-1
DTT Fisher Scientific BP172-25
Ecoline Immersion Thermostat E100 with 003 Bath LAUDA-Brinkmann 27709
EDTA Fisher Scientific BP118-500
EGTA Millipore Corporation 32462-25GM
FIJI / Image J https://fiji.sc/ N/A
Frosted Microscope Slides Corning 12-553-10 75mmx25mm, with thickness of 0.9-1.1mm
Glucose Oxidase MP Biomedicals LLC 195196 Type VII, without added oxygen
GMPCPP Jena Biosciences JBS-NU-405S Can be stored for several months at -20 °C and up to a year at -80 °C
Gold Seal-Cover Glass Thermo Scientific 3405
HEPES Fisher Scientific BP310-500
Imidazole Fisher Scientific 03196-500
IPTG Fisher Scientific BP1755-10
Laboratory dessicator Bel-Art 999320237 190mm plate size
Kanamycin Sulfate Fischer Scientific BP906-5
KIF5A K439 (aa:1-439)-6His Gilbert Lab, RPI N/A doi.org/10.1074/jbc.RA118.002182
Kimwipe Kimberley Clark Z188956 lint-free tissue
Immersion Oil, Type B Cargille 16484
Lens Tissue ThorLabs MC-5
LuNA Laser launch (4 channel: 405, 488, 561, 640nm) Nikon N/A
Lysozyme MP Biomedicals LLC 100834
Magnesium Acetate Tetrahydrate Fisher Scientific BP215-500
Microfuge 18 Beckman Coulter 367160
MPEG-SVA MW-5000 Laysan Bio, Inc. NC0107576
Neutravadin Invitrogen PI31000
Nikon Ti-E inverted microscope Nikon N/A Nikon LuN4 Laser
Ni-NTA Resin Thermo Scientific 88221
Oligonucleotide – CACCTATTCTGAGTTTGCGCGA
GAACTTTCAAAGGC
IDT N/A
Oligonucleotide – GCCTTTGAAAGTTCTCGCGCAA
ACTCAGAATAGGTG
IDT N/A
Open-top thickwall polycarbonate tube, 0.2 mL, 7 mm x 22 mm Beckman Coulter 343755
Optima-TLX Ultracentrifuge Beckman Coulter 361544
Paclitaxel (Taxol equivalent) Thermo Fisher Scientific P3456
PIPES ACROS Organics 172615000
PMSF Millipore 7110-5GM
Porcine Tubulin, biotin label Cytoskeleton, Inc. T333P
Porcine Tubulin, HiLyte 647 Fluor Cytoskeleton, Inc. TL670M far red labelled
Porcine Tubulin, Rhodamine Cytoskeleton, Inc. TL590M
Porcine Tubulin, Tubulin Protein Cytoskeleton, Inc. T240
Potassium Acetate Fisher Scientific BP364-500
Prime 95B sCMOS camera Photometric N/A
Quadrant Detector Sensor Head ThorLabs PDQ80A
Quikchange Lightning Kit Agilent Technologies 210518
Sodium Bicarbonate Fisher Scientific S233-500
Sodium Phosphate Dibasic Anhydrous Fisher Scientific BP332-500
Square Cover Glasses Corning 12-553-450 18 mm x 18 mm, with thickness of 0.13-0.17 mm
Streptavidin Microspheres Polysciences Inc. 24162-1
Superose-6 Column GE Healthcare 29-0915–96
TCEP Thermo Scientific 77720
TLA-100 Fixed-Angle Rotor Beckman Coulter 343840
Ultrasonic Cleaner (Sonicator) Vevor JPS-08A(DD) 304 stainless steel, 40 kHz frequency, 60 W power
Vectabond APTES solution Vector Laboratories SP-1800-7
Windex Powerized Glass Cleaner with Ammonia-D S.C. Johnson SJN695237

References

  1. Bentley, M., Banker, G. The cellular mechanisms that maintain neuronal polarity. Nature Reviews Neuroscience. 17 (10), 611-622 (2016).
  2. Yang, R., et al. A novel strategy to visualize vesicle-bound kinesins reveals the diversity of kinesin-mediated transport. Traffic. 20 (11), 851-866 (2019).
  3. Hirokawa, N., Niwa, S., Tanaka, Y. Molecular motors in neurons: Transport mechanisms and roles in brain function, development, and disease. Neuron. 68 (4), 610-638 (2010).
  4. Helmke, K. J., Heald, R., Wilbur, J. D. Interplay between spindle architecture and function. International Review of Cell and Molecular Biology. 306, (2013).
  5. Elting, M. W., Suresh, P., Dumont, S. The spindle: integrating architecture and mechanics across scales. Trends in Cell Biology. 28 (11), 896-910 (2018).
  6. Kapoor, T. Metaphase spindle assembly. Biologie. 6 (1), 8 (2017).
  7. Svoboda, K., Block, S. M. Force and velocity measured for single kinesin molecules. Cell. 77 (5), 773-784 (1994).
  8. Svoboda, K., Schmidt, C. F., Schnapp, B. J., Block, S. M. Direct observation of kinesin stepping by optical trapping interferometry. Nature. 365 (6448), 721-727 (1993).
  9. Schnitzer, M. J., Visscher, K., Block, S. M. Force production by single kinesin motors. Nature Cell Biology. 2 (10), 718-723 (2000).
  10. Andreasson, J. O. L., Shastry, S., Hancock, W. O., Block, S. M. The mechanochemical cycle of mammalian kinesin-2 KIF3A/B under load. Current Biology. 25 (9), 1166-1175 (2015).
  11. Bensel, B. M. The mechanochemistry of the kinesin-2 kif3ac heterodimer is related to strain-dependent kinetic properties of kif3a and kif3c. Proceedings of the National Academy of Sciences of the United States of America. 117 (27), 15632-15641 (2020).
  12. Gilbert, S. P., Guzik-Lendrun, S., Rayment, I. Kinesin-2 motors: kinetics and biophysics. Journal of Biological Chemistry. 293 (12), 4510-4518 (2018).
  13. Okada, Y., Higuchi, H., Hirokawa, N. Processivity of the single-headed kinesin KIF1A through binding to tubulin. Nature. 424 (6948), 574-577 (2003).
  14. Budaitis, B. G., et al. Pathogenic mutations in the kinesin-3 motor KIF1A diminish force generation and movement through allosteric mechanisms. Journal of Cell Biology. 220 (4), 202004227 (2021).
  15. Tomishige, M., Klopfenstein, D. R., Vale, R. D. Conversion of Unc104/KIF1A kinesin into a processive motor after dimerization. Science. 297 (5590), 2263-2267 (2002).
  16. Siddiqui, N., et al. Force generation of KIF1C is impaired by pathogenic mutations. bioRxiv. , (2021).
  17. Valentine, M. T., Fordyce, P. M., Krzysiak, T. C., Gilbert, S. P., Block, S. M. Individual dimers of the mitotic kinesin motor Eg5 step processively and support substantial loads in vitro. Nature Cell Biology. 8 (5), 470-476 (2006).
  18. Valentine, M. T., Gilbert, S. P. To step or not to step? How biochemistry and mechanics influence processivity in Kinesin and Eg5. Current Opinion in Cell Biology. 19 (1), 75-81 (2007).
  19. Jannasch, A., Bormuth, V., Storch, M., Howard, J., Schäffer, E. Kinesin-8 is a low-force motor protein with a weakly bound slip state. Biophysical Journal. 104 (11), 2456-2464 (2013).
  20. Bormuth, V., Varga, V., Howard, J., Schäffer, E. Protein friction limits diffusive and directed movements of kinesin motors on microtubules. Science. 325 (5942), 870-873 (2009).
  21. Gennerich, A., Carter, A. P., Reck-Peterson, S. L., Vale, R. D. Force-induced bidirectional stepping of cytoplasmic dynein. Cell. 131 (5), 952-965 (2007).
  22. Mallik, R., Carter, B. C., Lex, S. A., King, S. J., Gross, S. P. Cytoplasmic dynein functions as a gear in response to load. Nature. 427 (6975), 649-652 (2004).
  23. Redwine, W. B., et al. The human cytoplasmic dynein interactome reveals novel activators of motility. eLife. 6, 28257 (2017).
  24. Belyy, V., Hendel, N. L., Chien, A., Yildiz, A. Cytoplasmic dynein transports cargos via load-sharing between the heads. Nature Communications. 5 (1), 5544 (2014).
  25. Belyy, V., et al. The mammalian dynein-dynactin complex is a strong opponent to kinesin in a tug-of-war competition. Nature Cell Biology. 18 (9), 1018-1024 (2016).
  26. Subramanian, R., Kapoor, T. M. Building complexity: insights into self-organized assembly of microtubule-based architectures. Developmental Cell. 23 (5), 874-885 (2012).
  27. Forth, S., Kapoor, T. M. The mechanics of microtubule networks in cell division. Journal of Cell Biology. 216 (6), 1525-1531 (2017).
  28. Dumont, S., Mitchison, T. J. Force and length in the mitotic spindle. Current Biology. 19 (17), 749-761 (2009).
  29. McIntosh, J. R., Molodtsov, M. I., Ataullakhanov, F. I. Biophysics of mitosis. Quarterly Reviews of Biophysics. 45 (2), 147-207 (2012).
  30. McIntosh, J., Hays, T. A brief history of research on mitotic mechanisms. Biologie. 5 (4), 55 (2016).
  31. Ferenz, N. P., Gable, A., Wadsworth, P. Mitotic functions of kinesin-5. Seminars in Cell and Developmental Biology. 21 (3), 255-259 (2010).
  32. Kapitein, L. C., et al. The bipolar mitotic kinesin Eg5 moves on both microtubules that it crosslinks. Nature. 435 (7038), 114-118 (2005).
  33. Vukušić, K., Ponjavić, I., Buđa, R., Risteski, P., Tolić, I. M. Microtubule-sliding modules based on kinesins EG5 and PRC1-dependent KIF4A drive human spindle elongation. Developmental Cell. 56 (9), 1253-1267 (2021).
  34. Sturgill, E. G., Ohi, R. Kinesin-12 differentially affects spindle assembly depending on its microtubule substrate. Current Biology. 23 (14), 1280-1290 (2013).
  35. Drechsler, H., McHugh, T., Singleton, M. R., Carter, N. J., McAinsh, A. D. The Kinesin-12 Kif15 is a processive track-switching tetramer. eLife. 3, 01724 (2014).
  36. Tanenbaum, M. E., et al. Kif15 Cooperates with Eg5 to promote bipolar spindle assembly. Current Biology. 19 (20), 1703-1711 (2009).
  37. Mountain, V., et al. Cross-links microtubules in the mammalian mitotic spindle. Journal of Cell Biology. 147 (2), 351-365 (1999).
  38. Norris, S. R., et al. Microtubule minus-end aster organization is driven by processive HSET-tubulin clusters. Nature Communications. 9 (1), 2659 (2018).
  39. Cai, S., Weaver, L. N., Ems-McClung, S. C., Walczak, C. E. Proper organization of microtubule minus ends is needed for midzone stability and cytokinesis. Current Biology. 20 (9), 880-885 (2010).
  40. Pamula, M. C., et al. High-resolution imaging reveals how the spindle midzone impacts chromosome movement. Journal of Cell Biology. 218 (8), 2529-2544 (2019).
  41. Bieling, P., Telley, I. A., Surrey, T. A minimal midzone protein module controls formation and length of antiparallel microtubule overlaps. Cell. 142 (3), 420-432 (2010).
  42. Zhu, C., Lau, E., Schwarzenbacher, R., Bossy-Wetzel, E., Jiang, W. Spatiotemporal control of spindle midzone formation by PRC1 in human cells. Proceedings of the National Academy of Sciences of the United States of America. 103 (16), 6196-6201 (2006).
  43. Subramanian, R., et al. Insights into antiparallel microtubule crosslinking by PRC1, a conserved nonmotor microtubule binding protein. Cell. 142 (3), 433-443 (2010).
  44. Elting, M. W., Prakash, M., Udy, D. B., Dumont, S. Mapping load-bearing in the mammalian spindle reveals local kinetochore fiber anchorage that provides mechanical isolation and redundancy. Current Biology. 27 (14), 2112-2122 (2017).
  45. Fant, X., Merdes, A., Haren, L. Cell and molecular biology of spindle poles and NuMA. International Review of Cytology. 238, 1-57 (2004).
  46. Merdes, A., Heald, R., Samejima, K., Earnshaw, W. C., Cleveland, D. W. Formation of spindle poles by dynein/dynactin-dependent transport of NuMA). Journal of Cell Biology. 149 (4), 851-861 (2000).
  47. Maddox, P., Straight, A., Coughlin, P., Mitchison, T. J., Salmon, E. D. Direct observation of microtubule dynamics at kinetochores in Xenopus extract spindles: Implications for spindle mechanics. Journal of Cell Biology. 162 (3), 377-382 (2003).
  48. Maddox, P., Desai, A., Oegema, K., Mitchison, T. J., Salmon, E. D. Poleward microtubule flux is a major component of spindle dynamics and anaphase A in mitotic Drosophila embryos. Current Biology. 12 (19), 1670-1674 (2002).
  49. LaFountain, J. R., Cohan, C. S., Siegel, A. J., LaFountain, D. J. Direct visualization of microtubule flux during metaphase and anaphase in crane-fly spermatocytes. Molecular Biology of the Cell. 15 (12), 5724-5732 (2004).
  50. Pavin, N., Tolić, I. M. Mechanobiology of the mitotic spindle. Developmental Cell. 56 (2), 192-201 (2021).
  51. Vukušić, K., Tolić, I. M. Anaphase B: Long-standing models meet new concepts. Seminars in Cell and Developmental Biology. 117, 127-139 (2021).
  52. Vukušić, K., et al. Microtubule sliding within the bridging fiber pushes kinetochore fibers apart to segregate chromosomes. Developmental Cell. 43 (1), 11-23 (2017).
  53. Shimamoto, Y., Forth, S., Kapoor, T. M. Measuring pushing and braking forces generated by ensembles of kinesin-5 crosslinking two microtubules. Developmental Cell. 34 (6), 669-681 (2015).
  54. Gaska, I., Armstrong, M. E., Alfieri, A., Forth, S. The mitotic crosslinking protein PRC1 acts like a mechanical dashpot to resist microtubule sliding. Developmental Cell. 54 (3), 367-378 (2020).
  55. Woll, K. A., et al. An allosteric propofol-binding site in kinesin disrupts kinesin-mediated processive movement on microtubules. Journal of Biological Chemistry. 293 (29), 11283-11295 (2018).
  56. Forth, S., Hsia, K. C., Shimamoto, Y., Kapoor, T. M. Asymmetric friction of nonmotor MAPs can lead to their directional motion in active microtubule networks. Cell. 157 (2), 420-432 (2014).
  57. Alfieri, A., Gaska, I., Forth, S. Two modes of PRC1-mediated mechanical resistance to kinesin-driven microtubule network disruption. Current Biology. 31 (12), 2495-2506 (2021).
  58. Koch, M. D., Shaevitz, J. W. Introduction to optical tweezers. Methods in Molecular Biology. 1486, 3-24 (2017).
  59. Sarshar, M., Wong, W. T., Anvari, B. Comparative study of methods to calibrate the stiffness of a single-beam gradient-force optical tweezers over various laser trapping powers. Journal of Biomedical Optics. 19 (11), 115001 (2014).
  60. Van Mameren, J., Wuite, G. J. L., Heller, I. Introduction to optical tweezers: Background, system designs, and commercial solutions. Methods in Molecular Biology. 783, 1-20 (2011).
  61. Bodrug, T., et al. The kinesin-5 tail domain directly modulates the mechanochemical cycle of the motor domain for anti-parallel microtubule sliding. eLife. 9, 51131 (2020).
  62. Reinemann, D. N., et al. Collective force regulation in anti-parallel microtubule gliding by dimeric Kif15 kinesin motors. Current Biology. 27 (18), 2810-2820 (2017).
  63. Reinemann, D. N., Norris, S. R., Ohi, R., Lang, M. J. Processive kinesin-14 HSET exhibits directional flexibility depending on motor traffic. Current Biology:CB. 28 (14), 2356-2362 (2018).
  64. Shimamoto, Y., Forth, S., Kapoor, T. M. Measuring pushing and braking forces generated by ensembles of kinesin-5 crosslinking two microtubules. Developmental Cell. 34 (6), 669-681 (2015).
  65. . SMART – Servier Medical ART Available from: https://smart.servier.com/ (2022)
  66. Gaska, I., Armstrong, M., Alfieri, A., Forth, S. The mitotic crosslinking protein PRC1 acts as a mechanical dashpot to resist microtubule sliding. Developmental Cell. 54 (3), 1-14 (2020).
  67. Janson, M. E., De Dood, M. E., Dogterom, M. Dynamic instability of microtubules is regulated by force. Journal of Cell Biology. 161 (6), 1029-1034 (2003).
  68. Kerssemakers, J. W. J., et al. Assembly dynamics of microtubules at molecular resolution. Nature. 442 (7103), 709-712 (2006).
  69. Powers, A. F., et al. The Ndc80 kinetochore complex forms load-bearing attachments to dynamic microtubule tips via biased diffusion. Cell. 136 (5), 865-875 (2009).
  70. Akiyoshi, B., et al. Tension directly stabilizes reconstituted kinetochore-microtubule attachments. Nature. 468 (7323), 576-579 (2010).
  71. Fong, K. K., et al. Direct measurement of the strength of microtubule attachment to yeast centrosomes. Molecular Biology of the Cell. 28 (14), 1853-1861 (2017).
  72. Kikumoto, M., Kurachi, M., Tosa, V., Tashiro, H. Flexural rigidity of individual microtubules measured by a buckling force with optical traps. Biophysical Journal. 90 (5), 1687-1696 (2006).
  73. Memet, E., et al. Microtubules soften due to cross-sectional flattening. eLife. 7, 34695 (2018).
check_url/fr/63819?article_type=t

Play Video

Citer Cet Article
Palumbo, J., Tai, E., Forth, S. Directly Measuring Forces Within Reconstituted Active Microtubule Bundles. J. Vis. Exp. (183), e63819, doi:10.3791/63819 (2022).

View Video