Her presenterer vi en protokoll for rekonstituering av mikrotubulibunter in vitro og direkte kvantifisering av kreftene som utøves i dem ved hjelp av samtidig optisk fangst og total intern refleksjonsfluorescensmikroskopi. Denne analysen tillater nanoskalanivåmåling av kreftene og forskyvningene som genereres av proteinensembler i aktive mikrotubulinettverk.
Mikrotubulinettverk er ansatt i celler for å utføre et bredt spekter av oppgaver, alt fra å fungere som spor for vesikkeltransport til å fungere som spesialiserte arrays under mitose for å regulere kromosomsegregering. Proteiner som interagerer med mikrotubuli inkluderer motorer som kinesiner og dynein, som kan generere aktive krefter og retningsbestemt bevegelse, samt ikke-motoriske proteiner som kryssbinder filamenter i høyere ordens nettverk eller regulerer filamentdynamikk. Til dags dato har biofysiske studier av mikrotubuli-assosierte proteiner overveldende fokusert på rollen som enkeltmotorproteiner som trengs for vesikkeltransport, og det er gjort betydelige fremskritt i å belyse de kraftgenererende egenskapene og mekanokjemisk regulering av kinesiner og dyneiner. For prosesser der mikrotubuli fungerer både som last og spor, for eksempel under filamentglidning i den mitotiske spindelen, forstås imidlertid mye mindre om den biofysiske reguleringen av ensembler av de tverrbindende proteinene som er involvert. Her beskriver vi vår metodikk for direkte sondering av kraftgenerering og respons innen tverrbundne mikrotubuliminimale nettverk rekonstituert fra rensede mikrotubuli og mitotiske proteiner. Mikrotubulipar er tverrbundet av proteiner av interesse, en mikrotubuli er immobilisert til et mikroskopdeksel, og den andre mikrotubulien manipuleres av en optisk felle. Samtidig total intern refleksjonsfluorescensmikroskopi muliggjør flerkanals visualisering av alle komponentene i dette mikrotubulinettverket når filamentene glir fra hverandre for å generere kraft. Vi demonstrerer også hvordan disse teknikkene kan brukes til å sondere skyvekrefter som utøves av kinesin-5-ensembler og hvordan viskøse bremsekrefter oppstår mellom glidende mikrotubulipar tverrbundet av det mitotiske MAP PRC1. Disse analysene gir innsikt i mekanismene for spindelmontering og funksjon og kan tilpasses bredere for å studere tett mikrotubulinettverksmekanikk i ulike sammenhenger, for eksempel akson og dendritter av nevroner og polare epitelceller.
Celler benytter mikrotubulinettverk for å utføre et bredt spekter av mekaniske oppgaver, alt fra vesikkeltransport 1,2,3 til kromosomsegregering under mitose 4,5,6. Mange av proteinene som interagerer med mikrotubuli, som de molekylære motorproteinene kinesin og dynein, genererer krefter og reguleres av mekaniske belastninger. For bedre å forstå hvordan disse kritiske molekylene fungerer, har forskere brukt biofysiske metoder med ett molekyl, for eksempel optisk fangst og TIRF-mikroskopi, for direkte å overvåke kritiske parametere som lossede trinnhastigheter, prosessivitet og krafthastighetsforhold for individuelle proteiner. Den mest brukte eksperimentelle geometrien har vært å feste motorproteiner direkte til fangstperler hvis sfæriske geometri og størrelse etterligner vesikler som gjennomgår motordrevet transport. Tallrike kinesiner, inkludert kinesin-1 7,8,9, kinesin-2 10,11,12, kinesin-313,14,15,16 kinesin-517,18, kinesin-8 19,20, samt dynein og dynein komplekser21,22, 23,24,25, har blitt studert med disse metodene.
I mange cellulære prosesser bruker imidlertid motoriske og ikke-motoriske proteiner mikrotubuli både som spor og last26,27. Videre, i disse scenariene hvor mikrotubulifilamenter er tverrbundet til høyere ordens bunter, fungerer disse proteinene som ensembler i stedet for enkeltenheter. For eksempel, innenfor deling av somatiske celler, organiserer tette filamentnettverk seg selv for å bygge det mitotiske spindelapparatet28,29,30. Det interpolare spindelmikrotubulinettverket er svært dynamisk og er i stor grad ordnet med minus-ender som peker mot spindelpolene og plussendene overlappende nær spindelekvator. Filamenter i spindelen er tverrbundet av motoriske proteiner som kinesin-5 31,32,33, kinesin-12 34,35,36 og kinesin-1437,38,39, eller av ikke-motoriske proteiner som PRC1 40,41,42,43 eller NuMA 44,45, 46. De beveger seg ofte eller opplever mekanisk stress under prosesser som poleward flux eller mens de koordinerer kromosomsentrering under metafase eller kromosomsegregering under anafase 47,48,49,50,51,52. Integriteten til mikronskala spindelapparatet gjennom mitose er derfor avhengig av en nøye regulert balanse mellom skyve- og trekkkrefter generert og opprettholdt av dette nettverket av samvirkende filamenter. Imidlertid har verktøyene som trengs for å undersøke denne mekaniske reguleringen og forklare hvordan proteinensembler jobber sammen for å koordinere mikrotubulibevegelser og produsere kreftene som trengs for å montere spindelen riktig, bare nylig blitt utviklet, og vi begynner bare å forstå de biofysiske reglene som definerer dynamiske mikrotubulinettverk.
Målet med dette manuskriptet er å demonstrere trinnene som kreves for å rekonstituere tverrbundne mikrotubulipar in vitro, immobilisere disse buntene i et mikroskopikammer som muliggjør samtidig fluorescensvisualisering av både mikrotubuli og tverrbindingsproteiner og nanoskala kraftmåling, og behandle disse dataene robust. Vi beskriver trinnene som trengs for å stabilt polymerisere fluorescensmerkede mikrotubuli, forberede mikroskopdeksler for vedlegg, forberede polystyrenperler for optiske fangsteksperimenter og montere tverrbundne filamentnettverk som bevarer deres in vivo-funksjonalitet samtidig som de tillater direkte biofysisk manipulasjon.
Mikrotubuli-nettverk brukes av utallige celletyper for å utføre et bredt spekter av oppgaver som er fundamentalt mekaniske. For å beskrive hvordan celler fungerer i både friske og sykdomstilstander, er det avgjørende å forstå hvordan disse mikron-skala nettverkene er organisert og regulert av nanometer-størrelse proteiner som kollektivt bygger dem. Biofysiske verktøy som optisk pinsett er godt egnet til å undersøke mekanokjemien til nøkkelproteiner i denne skalaen. Komplekse eksperimentelle geometrier som bru…
The authors have nothing to disclose.
Forfatterne ønsker å anerkjenne støtte fra R21 AG067436 (til JP og SF), T32 AG057464 (til ET) og Rensselaer Polytechnic Institute School of Science Startup Funds (til SF).
10W Ytterbium Fiber Laser, 1064nm | IPG Photonics | YLR-10-1064-LP | |
405/488/561/640nm Laser Quad Band Set for TIRF applications | Chroma | TRF89901v2 | |
6x His Tag Antibody, Biotin Conjugate | Invitrogen | #MA1-21315-BTIN | |
Acetone, HPLC grade | Fisher Scientific | 18-608-395 | |
Alpha casein from bovine milk | Sigma | 1002484390 | |
ATP | Fisher Scientific | BP413-25 | |
Benzonase | Novagen | 70746-3 | |
Biotin-PEG-SVA-5000 | Laysan Bio, Inc. | NC0479433 | |
BL21 (DE3) Rosetta Cells | Millipore Sigma | 71-400-3 | |
Catalase | MP Biomedicals LLC | 190311 | |
CFI Apo 100X/1.49NA oil immersion TIRF objective | Nikon | N/A | |
Chloramphenicol | ACROS Organics | 227920250 | |
Coverslip Mini-Rack, for 8 coverslips | Fisher Scientific | C14784 | |
Delicate Task Wipers | Kimberly-Clark | 34120 | |
Dextrose Anhydrous | Fisher Scientific | BP3501 | |
D-Sucrose | Fisher Scientific | BP220-1 | |
DTT | Fisher Scientific | BP172-25 | |
Ecoline Immersion Thermostat E100 with 003 Bath | LAUDA-Brinkmann | 27709 | |
EDTA | Fisher Scientific | BP118-500 | |
EGTA | Millipore Corporation | 32462-25GM | |
FIJI / Image J | https://fiji.sc/ | N/A | |
Frosted Microscope Slides | Corning | 12-553-10 | 75mmx25mm, with thickness of 0.9-1.1mm |
Glucose Oxidase | MP Biomedicals LLC | 195196 | Type VII, without added oxygen |
GMPCPP | Jena Biosciences | JBS-NU-405S | Can be stored for several months at -20 °C and up to a year at -80 °C |
Gold Seal-Cover Glass | Thermo Scientific | 3405 | |
HEPES | Fisher Scientific | BP310-500 | |
Imidazole | Fisher Scientific | 03196-500 | |
IPTG | Fisher Scientific | BP1755-10 | |
Laboratory dessicator | Bel-Art | 999320237 | 190mm plate size |
Kanamycin Sulfate | Fischer Scientific | BP906-5 | |
KIF5A K439 (aa:1-439)-6His | Gilbert Lab, RPI | N/A | doi.org/10.1074/jbc.RA118.002182 |
Kimwipe | Kimberley Clark | Z188956 | lint-free tissue |
Immersion Oil, Type B | Cargille | 16484 | |
Lens Tissue | ThorLabs | MC-5 | |
LuNA Laser launch (4 channel: 405, 488, 561, 640nm) | Nikon | N/A | |
Lysozyme | MP Biomedicals LLC | 100834 | |
Magnesium Acetate Tetrahydrate | Fisher Scientific | BP215-500 | |
Microfuge 18 | Beckman Coulter | 367160 | |
MPEG-SVA MW-5000 | Laysan Bio, Inc. | NC0107576 | |
Neutravadin | Invitrogen | PI31000 | |
Nikon Ti-E inverted microscope | Nikon | N/A | Nikon LuN4 Laser |
Ni-NTA Resin | Thermo Scientific | 88221 | |
Oligonucleotide – CACCTATTCTGAGTTTGCGCGA GAACTTTCAAAGGC |
IDT | N/A | |
Oligonucleotide – GCCTTTGAAAGTTCTCGCGCAA ACTCAGAATAGGTG |
IDT | N/A | |
Open-top thickwall polycarbonate tube, 0.2 mL, 7 mm x 22 mm | Beckman Coulter | 343755 | |
Optima-TLX Ultracentrifuge | Beckman Coulter | 361544 | |
Paclitaxel (Taxol equivalent) | Thermo Fisher Scientific | P3456 | |
PIPES | ACROS Organics | 172615000 | |
PMSF | Millipore | 7110-5GM | |
Porcine Tubulin, biotin label | Cytoskeleton, Inc. | T333P | |
Porcine Tubulin, HiLyte 647 Fluor | Cytoskeleton, Inc. | TL670M | far red labelled |
Porcine Tubulin, Rhodamine | Cytoskeleton, Inc. | TL590M | |
Porcine Tubulin, Tubulin Protein | Cytoskeleton, Inc. | T240 | |
Potassium Acetate | Fisher Scientific | BP364-500 | |
Prime 95B sCMOS camera | Photometric | N/A | |
Quadrant Detector Sensor Head | ThorLabs | PDQ80A | |
Quikchange Lightning Kit | Agilent Technologies | 210518 | |
Sodium Bicarbonate | Fisher Scientific | S233-500 | |
Sodium Phosphate Dibasic Anhydrous | Fisher Scientific | BP332-500 | |
Square Cover Glasses | Corning | 12-553-450 | 18 mm x 18 mm, with thickness of 0.13-0.17 mm |
Streptavidin Microspheres | Polysciences Inc. | 24162-1 | |
Superose-6 Column | GE Healthcare | 29-0915–96 | |
TCEP | Thermo Scientific | 77720 | |
TLA-100 Fixed-Angle Rotor | Beckman Coulter | 343840 | |
Ultrasonic Cleaner (Sonicator) | Vevor | JPS-08A(DD) | 304 stainless steel, 40 kHz frequency, 60 W power |
Vectabond APTES solution | Vector Laboratories | SP-1800-7 | |
Windex Powerized Glass Cleaner with Ammonia-D | S.C. Johnson | SJN695237 |