JoVE Journal > Biochemistry
Summary
Abstract
Introduction
Protocol
Résultats
Discussion
Divulgations
Acknowledgements
Materials
References
Traduction automatique
Please note that all translations are automatically generated. Click here for the English version.
Biochimie

خط أنابيب للتحقيق في الهياكل ومسارات الإشارات لمستقبلات سفينغوزين 1-فوسفات

Published: June 08, 2022
doi:
10.3791/64054
, , , , , ,
1Division of Nephrology and Kidney Research Institute, State Key Laboratory of Biotherapy and Cancer Center, West China Hospital,Sichuan University, 2Department of Neurosurgery, West China Hospital,Sichuan University

Summary

يمارس S1P آثاره الفسيولوجية المتنوعة من خلال الفصيلة الفرعية لمستقبلات S1P (S1PRs). هنا ، يتم وصف خط أنابيب لشرح هياكل ووظيفة S1PRs.

Abstract

الليزوفوسفاتيدات (LPLs) هي دهون نشطة بيولوجيا تشمل سفينغوزين 1-فوسفات (S1P) ، وحمض الليسوفوسفاتيديك ، إلخ. S1P ، وهو منتج استقلابي من الدهون السفينغولية في غشاء الخلية ، هو واحد من أفضل LPLs المميزة التي تنظم مجموعة متنوعة من الاستجابات الفسيولوجية الخلوية عبر مسارات الإشارات بوساطة مستقبلات سفينغوزين 1-فوسفات (S1PRs). هذا ينطوي على أن نظام إشارات S1P-S1PRs هو هدف علاجي محتمل ملحوظ للاضطرابات ، بما في ذلك التصلب المتعدد (MS) ، واضطرابات المناعة الذاتية ، والسرطان ، والالتهابات ، وحتى COVID-19. تتكون S1PRs ، وهي مجموعة فرعية صغيرة من عائلة مستقبلات البروتين المقترن من الفئة A G (GPCR) ، من خمسة أنواع فرعية: S1PR1 و S1PR2 و S1PR3 و S1PR4 و S1PR5. ومع ذلك ، فإن الافتقار إلى المعلومات الهيكلية التفصيلية يعوق اكتشاف الأدوية التي تستهدف S1PRs. هنا ، طبقنا طريقة المجهر الإلكتروني المبرد لحل بنية مجمع S1P-S1PRs ، وأوضحنا آلية التنشيط ، والتعرف الانتقائي على الأدوية ، واقتران بروتين G باستخدام الفحوصات الوظيفية القائمة على الخلايا. يمكن أيضا دراسة مستقبلات الليزوفوسفوليبيد الأخرى (LPLRs) و GPCRs باستخدام هذه الاستراتيجية.

Introduction

Sphingosine-1-phosphate (S1P) ، وهو منتج استقلابي من الدهون السفينغولية في غشاء الخلية ، هو جزيء إشارات ليسوفوسفاتيدي في كل مكان يتضمن أنشطة بيولوجية مختلفة ، بما في ذلك الاتجار بالخلايا الليمفاوية ، وتطور الأوعية الدموية ، والسلامة البطانية ، ومعدل ضربات القلب1،2،3. يمارس S1P آثاره الفسيولوجية المتنوعة من خلال خمسة أنواع فرعية من مستقبلات S1P (S1PRs 1-5) ؛ تم العثور على S1PRs في مجموعة متنوعة من الأنسجة وتظهر تفضيلات فريدة لبروتينات G المصب 4,5. يقترن S1PR1 في المقام الأول ببروتين Gi ، الذي يمنع لاحقا إنتاج cAMP ؛ يقترن S1PR2 و S1PR3 ب Gi و Gq و G12/13 ، و S1PR4 و S1PR5 ينقلان الإشارة من خلال Gi و G12/136.

تعد إشارات S1P-S1PR هدفا علاجيا حاسما لأمراض متعددة ، بما في ذلك اضطرابات المناعة الذاتية7 والالتهاب8 والسرطان9 وحتى COVID-1910. في عام 2010 ، تم ترخيص fingolimod (FTY720) كأول دواء في فئته يستهدف S1PRs لعلاج التصلب المتعدد الانتكاسي (MS)11. ومع ذلك ، فهو قادر على الارتباط بجميع S1PRs باستثناء S1PR2 ، في حين أن الارتباط غير المحدد ب S1PR3 يؤدي إلى وذمة القشرة الدماغية ، وانقباض الأوعية الدموية والشعب الهوائية ، والتسرب الظهاري الرئوي12. كاستراتيجية بديلة لزيادة الانتقائية العلاجية ، تم إنتاج روابط خاصة بالنوع الفرعي للمستقبلات. تمت الموافقة على Siponimod (BAF312) في عام 2019 لعلاج التصلب المتعدد الانتكاسي13 ؛ يستهدف بشكل فعال S1PR1 و S1PR5 ، في حين أنه ليس لديه تقارب مع S1PR3 ، مما يدل على آثار جانبية أقل في الممارسة السريرية14. في عام 2020 ، أذنت إدارة الغذاء والدواء الأمريكية ب ozanimod لعلاج مرض التصلب العصبي المتعدد15. وقد أفيد أن أوزانيمود يحمل انتقائية أكبر بمقدار 25 ضعفا ل S1PR1 مقارنة ب S1PR516. والجدير بالذكر أنه في سياق جائحة COVID-19 الحالية ، تم اكتشاف أن الأدوية الناهضة التي تستهدف S1PRs يمكن استخدامها لعلاج COVID-19 باستخدام تقنيات العلاج المناعي17. بالمقارنة مع فينجوليمود ، أظهر أوزانيمود تفوقا في خفض الأعراض لدى مرضى COVID-19 ويخضع الآن للتجارب السريرية10. إن فهم الأساس الهيكلي ووظيفة S1PRs يضع أساسا مهما لتطوير دواء يستهدف بشكل انتقائي S1PRs18.

تستخدم العديد من التقنيات للتحقيق في المعلومات الهيكلية للجزيئات الحيوية الكبيرة ، بما في ذلك علم البلورات بالأشعة السينية ، والرنين المغناطيسي النووي (NMR) ، والمجهر الإلكتروني (EM). اعتبارا من مارس 2022 ، هناك أكثر من 180،000 هيكل مودع في بنك بيانات البروتين (PDB) ، وقد تم حل معظمها عن طريق علم البلورات بالأشعة السينية. ومع ذلك ، مع أول بنية دقة شبه ذرية ل TPRV1 (دقة 3.4 Å) التي أبلغ عنها Yifan Cheng و David Julius في 201319 ، أصبح المجهر الإلكتروني المبرد (cryo-EM) تقنية سائدة لهياكل البروتين ، وكان العدد الإجمالي لهياكل EM PDB أكثر من 10000. تتمثل مجالات الاختراق الحاسمة في تطوير كاميرات جديدة للتصوير تعرف باسم كاميرات الكشف المباشر عن الإلكترونات وخوارزميات معالجة الصور الجديدة. أحدثت Cryo-EM ثورة في بيولوجيا البنية واكتشاف الأدوية القائمة على البنية في العقد الماضي20. نظرا لأن فهم كيفية قيام المجمعات الجزيئية الكبيرة بأدوارها المعقدة في الخلية الحية هو موضوع مركزي في العلوم البيولوجية ، فإن cryo-EM لديه القدرة على الكشف عن تكوينات المجمعات الجزيئية الديناميكية ، خاصة بالنسبة للبروتينات عبر الغشاء21. مستقبلات G-protein المقترنة (GPCRs) هي أكبر عائلة فائقة من البروتينات عبر الغشاء وأهداف أكثر من 30٪ من المستحضرات الصيدلانية المسوقة حاليا22. ساهم تطوير cryo-EM في انفجار الهياكل عالية الدقة لمجمعات بروتين GPCR-G ، مما مكن من التحديد الهيكلي للأهداف “المستعصية” التي لا تزال غير متاحة للتحليل البلوري بالأشعة السينية في تصميم الأدوية23. وبالتالي ، يوفر تطبيق cryo-EM فرصة لتحديد البنية ثلاثية الأبعاد ل GPCRs في ظروف قريبة من الأصل بالقرب من الدقة الذرية24. إن التقدم في مجال التبريد الكهرومغناطيسي يجعل من الممكن تصور الأسس الميكانيكية لتحفيز GPCR أو تثبيطه ، والاستفادة بشكل أكبر في الكشف عن مواقع الربط الجديدة لإنشاء الأدوية المستهدفة GPCR25.

بالاعتماد على الخطوات الهائلة لتقنية cryo-EM ، حددنا هياكل مجمعات إشارات S1PR1 و S1PR3 و S1PR5-Gi المؤلمة مؤخرا26,27. في البشر ، توجد S1PRs في أنسجة مختلفة وتظهر تفضيلات فريدة لبروتينات G 4,5 في المراحل النهائية. يقترن S1PR1 في المقام الأول ببروتين Gi ، الذي يمنع لاحقا إنتاج أحادي فوسفات الأدينوسين الدوري 3 ′ ، 5 ′ (cAMP). S1PR3 و S1PR5 قادران أيضا على الاقتران مع Gi 6,28. نظرا لأن تنشيط مستقبلات Gi-pair يقلل من إنتاج cAMP29 ، فقد تم إدخال فحص cAMP لتثبيط Gi لقياس تأثيرات تثبيط cAMP لالتقاط التعديلات الوظيفية26,27. باستخدام نسخة متحولة من Photinus pyralis luciferase حيث تم إدخال بروتين ملزم ل cAMP ، يوفر فحص cAMP هذا طريقة بسيطة وموثوقة لمراقبة نشاط GPCR من خلال التغيرات في تركيز cAMPداخل الخلايا 30. وهو اختبار وظيفي حساس وغير مشع ويمكن تطبيقه لمراقبة الإشارات النهائية في الوقت الحقيقي لمجموعة واسعة من GPCRs لأغراض اكتشاف الأدوية31.

هنا ، يتم تقديم ملخص للطرق الحاسمة في حل طرق التنشيط والتعرف على الأدوية ل S1PRs ، بما في ذلك في المقام الأول التلاعب بالتبريد EM وفحص cAMP المثبط Gi. تهدف هذه المقالة إلى توفير إرشادات تجريبية شاملة لمزيد من الاستكشافات في هياكل ووظائف GPCRs.

Protocol

1. تنقية مركب البروتين S1PRs-G لتنقية مركب البروتين S1PRs-G البشري ، قم باستنساخ cDNAs من S1PR1 التي تفتقر إلى بقايا C-terminal 338-382 ، والنوع البري S1PR3 ، و S1PR5 المبتور مع 345-398 في المحطة C ، والنوع البري Gi1 في ناقل pFastBac1 و cDNAs من النوع البري Gβ1 و Gγ2 في ناقل pFastBacdual (جدول المواد).ملاحظة: تحتو?…

Representative Results

قبل تجميد عينة مركب S1PRs-Gi ، يجب فصل العينة النقية بواسطة كروماتوغرافيا استبعاد الحجم (SEC) وتحليلها باستخدام كروماتوغرافيا ترشيح الهلام. يوضح الشكل 2 مجمع S1PR3-Gi كمثال. عادة ما كان الجزء الأقصى من مركب بروتين GPCR-G المتجانس يقع عند ~ 10.5 مل من كروماتوغرافيا استبعاد الحجم (<strong class="xf…

Discussion

يصف هذا البروتوكول خط أنابيب أساسي لتحديد هياكل S1PRs بواسطة cryo-EM وقياس فعالية تنشيط S1PRs بواسطة اختبار تثبيط cAMP بوساطة Gi. بعض الخطوات حاسمة لنجاح التجربة.

لتنقية مجمع S1PRs-Gi ، يجب إيلاء المزيد من الاهتمام لجودة الفيروس وصحة خلايا sf9 . يتم تقليل التعبير عن المستقبل بشكل كبير ف…

Divulgations

The authors have nothing to disclose.

Acknowledgements

تم جمع بيانات مجمع S1PRs-Gi في مركز غرب الصين Cryo-EM في جامعة سيتشوان ومركز Cryo-EM في الجامعة الجنوبية للعلوم والتكنولوجيا (SUSTech) ومعالجتها في مركز Duyu للحوسبة عالية الأداء في جامعة سيتشوان. تم دعم هذا العمل من قبل مؤسسة العلوم الطبيعية الصينية (32100965 إلى L.C. ، 32100988 إلى W.Y. ، 31972916 إلى Z.S.) وصندوق أبحاث ما بعد الدكتوراه بدوام كامل من جامعة سيتشوان (2021SCU12003 إلى L.C.)

Materials

0.05% trypsin-EDTA GIBCO Cat# 25300054
0.22 µM filter Thermo Fisher Scientific Cat# 42213-PS
100 kDa cut-off concentrator Thermo Fisher Scientific Cat# 88533
6-well plate Corning Cat# 43016
96-well plate Corning Cat# 3917
Aprotinin Sigma-Aldrich Cat# 9087-70-1
Apyrase NEB Cat# M0398S
Baculovirus transfection reagent Thermo Fisher Scientific Cat# 10362100 For the preparation of P0 baculovirus
Benzamidine Sigma-Aldrich Cat# B6506
CHO-K1 ATCC N/A
CHS Sigma-Aldrich Cat# C6512
CryoSPARC Punjani, A., et al.,2017 https://cryosparc.com/
DH5α competent E.coli Thermo Fisher Scientific Cat# EC0112
D-Luciferin-Potassium Salt Sigma- Aldrich Cat# 50227
DMSO Sigma- Aldrich Cat# D2438
EDTA Thermo Fisher Scientific Cat# S311-500
ESF921 cell culture medium Expression Systems Cat#  96-001
Excel microsoft N/A
F12 medium Invitrogen Cat# 11765
FBS Cell Box Cat# SAG-01U-02
Flag resin Sigma- Aldrich Cat# A4596
Forskolin APExBIO Cat# B1421
Gctf Zhang, 2016  https://www.mrc-lmb.cam.ac.uk/kzhang/Gctf/
GDN Anatrace Cat# GDN101
Gel filtration column GE healthcare Cat# 28990944
Gen5 3.11 BIO-TEK N/A
Gentamicin Solarbio Cat# L1312
GloSensor cAMP assay kit Promega Cat# E1291 Gi-inhibition cAMP assay kit
GloSensor plasmid Promega Cat# E2301 Sensor plasmid
Grace’s medium GIBCO Cat# 11595030
GraphPad Prism 8 Graphpad N/A
HBSS Thermo Fisher Scientific Cat# 88284
HEPES Sigma- Aldrich Cat# H4034
jetPRIME Reagent Polyplus Transfection Cat# 114-15 transfection reagent
Janamycin Solarbio Cat# K1030
LB medium Invitrogen Cat# 12780052
Leupeptin Sigma-Aldrich Cat# L2884
LMNG Anatrace Cat# NG310
MotionCor2 (Zheng et al., 2017) https://emcore.ucsf.edu/ucsf-software
NanoCab Thermo Fisher Scientific Cat# 1121822
PBS Invitrogen Cat# 14190-144
pcDNA3.1-HA-FLAG-S1PRs GenScript N/A
pFastBac1-Gαi GenScript N/A
pFastBac1-HA-FLAG-T4L-S1PRs-His10 GenScript N/A
pFastBacdual-Gβ1γ2 GenScript N/A
PureLink HiPure Plasmid Miniprep Kit Invitrogen Cat# K210003 For the preparation of plasmids and P0 baculovirus
Q5 site-Directed Mutagenesis kit NEB Cat# E0554S For the preparation of plasmids
Quantifoil Quantifoil Cat# 251448
RELION-3.1 (Zivanov et al., 2018) https://www2.mrc-lmb.cam.ac.uk/relion
S1PRs cDNA addgene N/A
scFv16 Invitrogen Cat# 703976
Sf9 Expression Systems N/A
Siponimod Selleck Cat# S7179
sodium cholate Sigma-Aldrich Cat# C1254
Synergy H1 microplate reader BIO-TEK N/A
Synthetic T4L DNA (sequence) N/A N/A Aacatcttcgagatgctgcgcatcgacgaagg
cctgcgtctcaagatttacaagaataccgaagg
ttattacacgattggcatcggccacctcctgaca
aagagcccatcactcaacgctgccaagtctga
actggacaaagccattggtcgcaacaccaac
ggtgtcattacaaaggacgaggcggagaaac
tcttcaaccaagatgtagatgcggctgtccgtgg
catcctgcgtaatgccaagttgaagcccgtgt
atgactcccttgatgctgttcgccgtgcagcctt
gatcaacatggttttccaaatgggtgagaccgg
agtggctggttttacgaactccctgcgcatgctcc
agcagaagcgctgggacgaggccgcagtga
atttggctaaatctcgctggtacaatcagacacc
taaccgtgccaagcgtgtcatcactaccttccg
tactggaacttgggacgcttac
TCEP Thermo Fisher Scientific Cat# 77720
Tetracycline Solarbio Cat# T8180
Vitrobot Mark IV Thermo Fisher Scientific N/A
DOWNLOAD MATERIALS LIST

References

  1. Verstockt, B., et al. Sphingosine 1-phosphate modulation and immune cell trafficking in inflammatory bowel disease. Nature Reviews: Gastroenterology & Hepatology. , 1-16 (2022).
  2. Rosen, H., Stevens, R. C., Hanson, M., Roberts, E., Oldstone, M. B. Sphingosine-1-phosphate and its receptors: structure, signaling, and influence. Annual Review of Biochemistry. 82, 637-662 (2013).
  3. Cartier, A., Hla, T. Sphingosine 1-phosphate: Lipid signaling in pathology and therapy. Science. 366 (6463), 5551 (2019).
  4. Jozefczuk, E., Guzik, T. J., Siedlinski, M. Significance of sphingosine-1-phosphate in cardiovascular physiology and pathology. Pharmacological Research. 156, 104793 (2020).
  5. Kihara, Y., Maceyka, M., Spiegel, S., Chun, J. Lysophospholipid receptor nomenclature review: IUPHAR Review 8. British Journal of Pharmacology. 171 (15), 3575-3594 (2014).
  6. Bryan, A. M., Del Poeta, M. Sphingosine-1-phosphate receptors and innate immunity. Cellular Microbiology. 20 (5), 12836 (2018).
  7. Pelletier, D., Hafler, D. A. Fingolimod for multiple sclerosis. New England Journal of Medicine. 366 (4), 339-347 (2012).
  8. Obinata, H., Hla, T. Sphingosine 1-phosphate and inflammation. International Immunology. 31 (9), 617-625 (2019).
  9. Pyne, N. J., Pyne, S. Sphingosine 1-phosphate and cancer. Nature Reviews: Cancer. 10 (7), 489-503 (2010).
  10. Abu-Farha, M., et al. The role of lipid metabolism in COVID-19 virus infection and as a drug target. International Journal of Molecular Sciences. 21 (10), 3544 (2020).
  11. Chun, J., Kihara, Y., Jonnalagadda, D., Blaho, V. A. Fingolimod: lessons learned and new opportunities for treating Multiple Sclerosis and other disorders. Annual Review of Pharmacology and Toxicology. 59, 149-170 (2019).
  12. Murakami, A., et al. Sphingosine 1-phosphate (S1P) regulates vascular contraction via S1P3 receptor: investigation based on a new S1P3 receptor antagonist. Molecular Pharmacology. 77 (4), 704-713 (2010).
  13. Cao, L., et al. Siponimod for multiple sclerosis. Cochrane Database of Systematic Reviews. 11, (2021).
  14. Scott, L. J. Siponimod: a review in secondary progressive Multiple Sclerosis. CNS Drugs. 34 (11), 1191-1200 (2020).
  15. Lamb, Y. N. Ozanimod: first approval. Drugs. 80 (8), 841-848 (2020).
  16. Scott, F. L., et al. Ozanimod (RPC1063) is a potent sphingosine-1-phosphate receptor-1 (S1P1) and receptor-5 (S1P5) agonist with autoimmune disease-modifying activity. British Journal of Pharmacology. 173 (11), 1778-1792 (2016).
  17. McGowan, E. M., Haddadi, N., Nassif, N. T., Lin, Y. Targeting the SphK-S1P-SIPR pathway as a potential therapeutic approach for COVID-19. International Journal of Molecular Sciences. 21 (19), 7189 (2020).
  18. O’Sullivan, C., Dev, K. K. The structure and function of the S1P1 receptor. Trends in Pharmacological Sciences. 34 (7), 401-412 (2013).
  19. Liao, M., Cao, E., Julius, D., Cheng, Y. Structure of the TRPV1 ion channel determined by electron cryo-microscopy. Nature. 504 (7478), 107-112 (2013).
  20. Bai, X. C., McMullan, G., Scheres, S. H. How cryo-EM is revolutionizing structural biology. Trends in Biochemical Sciences. 40 (1), 49-57 (2015).
  21. Murata, K., Wolf, M. Cryo-electron microscopy for structural analysis of dynamic biological macromolecules. Biochimica et Biophysica Acta General Subjects. 1862 (2), 324-334 (2018).
  22. Zhang, M., et al. Cryo-EM structure of an activated GPCR-G protein complex in lipid nanodiscs. Nature Structural & Molecular Biology. 28 (3), 258-267 (2021).
  23. Renaud, J. P., et al. Cryo-EM in drug discovery: achievements, limitations and prospects. Nature Reviews: Drug Discovery. 17 (7), 471-492 (2018).
  24. Ishchenko, A., Gati, C., Cherezov, V. Structural biology of G protein-coupled receptors: new opportunities from XFELs and cryoEM. Current Opinion in Structural Biology. 51, 44-52 (2018).
  25. Yang, D., et al. G protein-coupled receptors: structure- and function-based drug discovery. Signal Transduction and Targeted Therapy. 6 (1), 7 (2021).
  26. Yuan, Y., et al. Structures of signaling complexes of lipid receptors S1PR1 and S1PR5 reveal mechanisms of activation and drug recognition. Cell Research. 31 (12), 1263-1274 (2021).
  27. Zhao, C., et al. Structural insights into sphingosine-1-phosphate recognition and ligand selectivity of S1PR3-Gi signaling complexes. Cell Research. 32 (2), 218-221 (2022).
  28. Xu, Z., et al. Structural basis of sphingosine-1-phosphate receptor 1 activation and biased agonism. Nature Chemical Biology. 18, 281-288 (2022).
  29. Liu, Y. F., Ghahremani, M. H., Rasenick, M. M., Jakobs, K. H., Albert, P. R. Stimulation of cAMP synthesis by Gi-coupled receptors upon ablation of distinct Galphai protein expression. Gi subtype specificity of the 5-HT1A receptor. Journal of Biological Chemistry. 274 (23), 16444-16450 (1999).
  30. Buccioni, M., et al. Innovative functional cAMP assay for studying G protein-coupled receptors: application to the pharmacological characterization of GPR17. Purinergic Signalling. 7 (4), 463-468 (2011).
  31. Wang, F. I., Ding, G., Ng, G. S., Dixon, S. J., Chidiac, P. Luciferase-based GloSensor cAMP assay: Temperature optimization and application to cell-based kinetic studies. Methods. , (2021).
  32. Audet, M., et al. Small-scale approach for precrystallization screening in GPCR X-ray crystallography. Nature Protocols. 15 (1), 144-160 (2020).
  33. Sgro, G. G., Costa, T. R. D. Cryo-EM grid preparation of membrane protein samples for single particle analysis. Frontiers in Molecular Biosciences. 5, 74 (2018).
  34. White, J. B. R., et al. Single particle cryo-electron microscopy: from sample to structure. Journal of Visualized Experiments. (171), e62415 (2021).
  35. Thompson, R. F., Iadanza, M. G., Hesketh, E. L., Rawson, S., Ranson, N. A. Collection, pre-processing and on-the-fly analysis of data for high-resolution, single-particle cryo-electron microscopy. Nature Protocols. 14 (1), 100-118 (2019).
  36. Fernandez-Leiro, R., Scheres, S. H. W. A pipeline approach to single-particle processing in RELION. Acta Crystallographica Section D. 73 (6), 496-502 (2017).
  37. Punjani, A., Rubinstein, J. L., Fleet, D. J., Brubaker, M. A. cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. Nature Methods. 14 (3), 290-296 (2017).
  38. Brilot, A. F., et al. Beam-induced motion of vitrified specimen on holey carbon film. Journal of Structural Biology. 177 (3), 630-637 (2012).
  39. Zheng, S. Q., et al. MotionCor2: anisotropic correction of beam-induced motion for improved cryo-electron microscopy. Nature Methods. 14 (4), 331-332 (2017).
  40. Zhang, K. Gctf: Real-time CTF determination and correction. Journal of Structural Biology. 193 (1), 1-12 (2016).
  41. Scheres, S. H. Semi-automated selection of cryo-EM particles in RELION-1.3. Journal of Structural Biology. 189 (2), 114-122 (2015).
  42. Liu, S., et al. Differential activation mechanisms of lipid GPCRs by lysophosphatidic acid and sphingosine 1-phosphate. Nature Communications. 13 (1), 731 (2022).
  43. Duan, J., et al. Cryo-EM structure of an activated VIP1 receptor-G protein complex revealed by a NanoBiT tethering strategy. Nature Communications. 11 (1), 4121 (2020).
  44. DiIorio, M. C., Kulczyk, A. W. A robust single-particle cryo-electron microscopy (cryo-EM) processing workflow with cryoSPARC, RELION, and Scipion. Journal of Visualized Experiments. (179), e63387 (2022).
  45. Pradelles, P., Grassi, J., Chabardes, D., Guiso, N. Enzyme immunoassays of adenosine cyclic 3′,5′-monophosphate and guanosine cyclic 3′,5′-monophosphate using acetylcholinesterase. Analytical Chemistry. 61 (5), 447-453 (1989).
  46. Jiang, L. I., et al. Use of a cAMP BRET sensor to characterize a novel regulation of cAMP by the sphingosine 1-phosphate/G13 pathway. Journal of Biological Chemistry. 282 (14), 10576-10584 (2007).

Tags

Sphingosine 1-phosphate ReceptorsS1PRActivationDrug DevelopmentCryo-electron MicroscopyProtein PurificationSize Exclusion Chromatography2D ClassificationImage ProcessingAuto-picking
check_url/fr/64054?article_type=t

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Citer Cet Article
Cheng, L., Su, L., Tian, X., Xia, F., Zhao, C., Yan, W., Shao, Z. A Pipeline to Investigate the Structures and Signaling Pathways of Sphingosine 1-Phosphate Receptors. J. Vis. Exp. (184), e64054, doi:10.3791/64054 (2022).
Télécharger la Citation
Réimpressions et Autorisations

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image