Given their simple anatomy, Anopheles testes offer a good cytological model for studying spermatogenesis. This protocol describes whole-mount fluorescence in situ hybridization, a technique used to investigate this biological process, as well as the phenotype of transgenic strains harboring mutations in the genes involved in sperm production.
Spermatogenesis is a complex biological process during which diploid cells undergo successive mitotic and meiotic division followed by large structural changes to form haploid spermatozoa. Besides the biological aspect, studying spermatogenesis is of paramount importance for understanding and developing genetic technologies such as gene drive and synthetic sex ratio distorters, which, by altering Mendelian inheritance and the sperm sex ratio, respectively, could be used to control pest insect populations. These technologies have proven to be very promising in lab settings and could potentially be used to control wild populations of Anopheles mosquitoes, which are vectors of malaria. Due to the simplicity of the testis anatomy and their medical importance, Anopheles gambiae, a major malaria vector in sub-Saharan Africa, represents a good cytological model for studying spermatogenesis. This protocol describes how whole-mount fluorescence in situ hybridization (WFISH) can be used to study the dramatic changes in cell nuclear structure through spermatogenesis using fluorescent probes that specifically stain the X and Y chromosomes. FISH usually requires the disruption of the reproductive organs to expose mitotic or meiotic chromosomes and allow the staining of specific genomic regions with fluorescent probes. WFISH enables the preservation of the native cytological structure of the testis, coupled with a good level of signal detection from fluorescent probes targeting repetitive DNA sequences. This allows researchers to follow changes in the chromosomal behavior of cells undergoing meiosis along the structure of the organ, where each phase of the process can clearly be distinguished. This technique could be particularly useful for studying chromosome meiotic pairing and investigating the cytological phenotypes associated with, for example, synthetic sex ratio distorters, hybrid male sterility, and the knock-out of genes involved in spermatogenesis.
Malaria imposes an enormous burden on the health and well-being of the global human population. In 2021, the World Health Organization (WHO) estimated that malaria caused 619,000 deaths, of which 96% occurred in Sub-Saharan Africa1. The disease is transmitted by mosquitoes belonging to the Anopheles genus, and in Sub-Saharan Africa, three species, namely Anopheles gambiae (An. gambiae), Anopheles coluzzi (An, coluzzi) and Anopheles arabiensis (An. Arabiensis) have a disproportionately large role in malaria transmission, accounting for 95% of malaria cases globally. Control programs relying on traditional methods such as insecticides and antimalarial drugs have saved millions of lives; however, in recent years, the rising resistance to these control methods has challenged their efficacy1,2. In addition, restrictions imposed by the COVID-19 pandemic have affected the availability of key malaria control interventions, which, according to the 2022 WHO World Malaria Report, has increased malaria incidence1. In the last two decades, novel genetic control methods have been developed in laboratory settings to target Anopheles mosquitoes3,4,5,6,7,8,9,10. Among these strategies, those based on gene drive systems (GDSs) and synthetic sex ratio distorters (SDs) seem promising. GDSs rely on the possibility of transmitting, at a very high frequency, a genetic modification that affects female fertility or impairs the parasite life cycle in the mosquito5,11,12. SDs, instead, act by skewing the sex ratio of a mosquito progeny toward males, which leads, over time, to the collapse of a target population due to a lack of females4,6,13. The main components of these genetic systems act primarily on the reproductive organs of the mosquitoes, where the gametes, eggs, and sperm are produced following meiotic division14.
In this protocol, advances in cytogenetic techniques are employed to explore spermatogenesis in An. gambiae focusing on the chromosomes' behavior in situ. The structure of the mosquito testis and the biological processes that take place within it have been previously investigated using a number of cytological methods, such as immunofluorescence, fluorescent reporter transgenes, and DNA and RNA fluorescence in situ hybridization (FISH)15,16,17,18,19,20; the organs show a spindle-like shape, in which the lower pole is attached to a deferent duct connected to the male accessory glands. In the upper pole, the germline stem cells niche proliferates and differentiates into spermatogonia cells embedded inside spermatocysts formed by somatic cells. Following multiple rounds of mitotic division, the spermatogonia differentiate into spermatocytes, which enter meiosis. At prophase, autosome and sex chromosomes pair with their homologs, and crossing over takes place. After the meiotic divisions, round haploid spermatids are generated and enter spermiogenesis, and this process leads to the formation of mature haploid spermatozoa in which the cytoplasm has been removed, the nuclear chromatin is condensed, and flagella emerge at the basal part of the nuclei21,22 (Figure 1 and Figure 2).
In general, spermiogenesis starts around the mid-pupal stage, and mature spermatozoa can be detected in the late pupal stage in the sperm reservoir23. The maturation process of the spermatocysts continues during adult life23,24,25. In Anopheles testes, each step of spermatogenesis can be easily identified by looking at the nuclear morphology of the cells in each spermatocyst (Figure 2). Whole-mount fluorescence in situ hybridization (WFISH), described in this protocol, allows researchers to specifically label a chromosomal region and track it during spermatogenesis while preserving the native structure of the organ and cell nuclei position; this represents an advantage when compared to the standard DNA FISH protocol in which the organ is usually squashed, leading to tissue damage19. In the current protocol, fluorescent probes are used to stain repetitive sequences on the sex chromosomes and, thus, track their behavior during spermatogenesis, from diploid dividing cells to mature haploid spermatozoa. WFISH can be particularly useful for studying sex chromosome meiotic pairing and investigating the cytological phenotypes associated with, for example, synthetic sex ratio distorters, hybrid male sterility, and the knock-out of genes involved in spermatogenesis4,19,26,27.
Given their role as malaria vectors, Anopheles mosquitoes are the target of an increasing number of genetic vector control strategies, which often act in the reproductive organs of these organisms. Several mosquito mutants and cytological phenotypes have been generated that require novel cytological techniques to be investigated26,27,28,29. The method described in this study sheds light on the understanding of spermatogenesis, as well as the cytological mechanisms behind genetic strategies that have the potential to control malaria-transmitting mosquitoes.
Commonly, FISH protocols require the squashing of the organ of interest to allow for chromosome staining. This causes a loss of information regarding the spatial arrangement of the cells within that organ33. This protocol describes how biological processes, such as spermatogenesis, can be studied in situ while maintaining the intact native structure of the testis and its internal cytological organization. Probes targeting different DNA repetitive elements, which are particularly enriched in sex chromosomes20, can be simultaneously used to reveal the dynamics of sperm maturation. Depending on the timing of the testis dissection, WFISH offers the opportunity to study different stages of spermatogenesis through mosquito development. WFISH is useful for studying specific phenomena such as hybrid incompatibility, which, in Anopheles mosquitoes, is due to the presence of meiotic defects such as premeiotic failure and sex chromosome non-disjunction19,34,35. Besides the biological aspect, spermatogenesis is the target of a number of genetic strategies developed to control pest insects such as Anopheles mosquitoes. In this context, the X-linked rDNA locus of An. gambiae has been used as a target to develop a synthetic sex ratio distorter, which, by damaging X-bearing sperms, biases the progeny toward males4,8,13.
This technology mirrors the action of natural sex ratio meiotic drives that have been identified in several taxa, including mosquitoes, but that still remain poorly understood28,36,37,38,39,40,41. WFISH offers the opportunity to investigate this phenomenon and paves the way for refining or improving sex distortion-based genetic strategies by, for example, providing information on how the cytology of sperm production is affected by the choice of the target sites used for sex chromosome shredding. Although, in our experience, WFISH shows high chances of success, failure can still occur. This might be due to an inefficient level of tissue permeabilization, which can be overcome by increasing the incubation time of the penetrating solution. Alternatively, Proteinase K can be used during the permeabilization step. In some cases, we noticed a non-uniform level of probe penetration, with a higher signal in spermatocytes nuclei and a lower or absent signal in the meiotic and spermiogenesis stages. This might be due to a difference in the permeabilization level depending on the cell stage. In addition, WFISH proved to be valuable when using fluorescent probes designed to target DNA sequences present in high copy numbers. When targeting single-copy genes, the signal detection may not be sufficient. In this case, methods for signal amplification, such as tyramide signal amplification (TSA), must be integrated42.
This protocol could be coupled with immunostaining or with transgenic reporter strains harboring germline-specific fluorescent markers16,18, as this would add information about protein localization and gene expression in situ. In this work, WFISH is described as a technique to investigate spermatogenesis in Anopheles mosquitoes; however, given the shared anatomy of male reproductive organs, this protocol could be applied to other mosquito species that play a role in disease transmission. Similarly, female gametogenesis could be investigated using this technique. In addition, cytological studies in organs or tissues of interest, such as the mosquito midgut, which is a target for parasite invasion, or atypical genetic backgrounds, such as those in hybrid mosquitoes, could be explored43. Moreover, this technique can potentially be transferred to other organisms within the Diptera order.
The authors have nothing to disclose.
This work was supported by a grant from the Bill & Melinda Gates Foundation and Open Philanthropy. We thank the Facility for Imaging by Light Microscopy (FILM) at Imperial College London for the microscopy analysis. Figure 2 was created with Biorender.com.
Amersham CyDye Fluorescent Nucleotides, Cy3-dUTP | Cytiva | PA53022 | |
Amersham CyDye Fluorescent Nucleotides, Cy5-dUTP | Cytiva | PA55022 | |
ART Wide Bore Filtered Pipette Tips | ThermoFisher Scientific | 2079GPK | |
CytoBond Removable Coverslip Sealant | SciGene | 2020-00-1 | |
Dextran sulfate sodium salt from Leuconostoc spp. | Sigma-Aldrich | D8906-5G | |
DNeasy Blood & Tissue Kits | Qiagen | 69504 | |
Embryo Dishes | VWR | 70543-30 | |
Ethanol, molecular grade | Sigma-Aldrich | 51976 | |
Formamide | ThermoFisher Scientific | 17899 | |
GoTaq G2 DNA Polymerase | Promega | M7841 | |
Hydrochloric acid, 37% | Sigma-Aldrich | 320331 | |
Microscope slides, SuperFrost | VWR | 631-0114 | |
PBS (10x), pH 7.4 | ThermoFisher Scientific | 70011044 | |
Pierce 16% Formaldehyde (w/v), Methanol-free | ThermoFisher Scientific | 28906 | |
ProLong Gold Antifade Mountant with DAPI | ThermoFisher Scientific | P36941 | |
RNase A/T1 Mix | ThermoFisher Scientific | EN0551 | |
Set of dATP, dCTP, dGTP, dTTP | Promega | U1330 | |
Sodium Acetate Solution | ThermoFisher Scientific | R1181 | |
SP8 inverted confocal microscope | Leica | ||
Triton X-100 | Sigma-Aldrich | 9036-19-5 | |
TWEEN 20 | Sigma-Aldrich | P1379 | |
UltraPure Salmon Sperm DNA Solution | ThermoFisher Scientific | 15632011 | |
UltraPure SSC 20x | ThermoFisher Scientific | 15557044 | |
Primer sequences | |||
5’-CAATAAATTTCCTTTTTAATGATGC AAAATCTACGTCTCTAGC-3’-[Fluorochrome] |
Eurofins Genomics | Contig_240 (X) | |
5’AGAAGAATAGAATCAGAATAGT CGG TTTCTTCATCCTGAAAGCC-3’-[Fluorochrome] |
Eurofins Genomics | AgY53B (Y) | |
5’-TTCTAAGTTTCTAGGCTTTAAGGA T GAAGAAACCGACTATTC-3’-[Fluorochrome] |
Eurofins Genomics | AgY477- AgY53B junction region (Y) |
|
F: AACTGTGGAAAAGCCAGAGC R: TCCACTTGATCCTTGCAAAA |
Eurofins Genomics | 18S rDNA (X) | |
F: CCTTTAAACACATGCTCAAATT R: GTTTCTTCATCCTTAAAGCCTAG |
Eurofins Genomics | AgY53B (Y) |