खमीर एकाधिक जीन विलोपन ले उपभेदों की पीढ़ी के लिए ग्रीन दानव प्रक्रिया

Summary

ग्रीन दानव विधि एकाधिक एक संवाददाता जीन एन्कोडिंग हरे फ्लोरोसेंट प्रोटीन के साथ चिह्नित विलोपन के तेजी से विधानसभा के लिए सक्षम बनाता है. इस विधि खमीर उपभेदों विलोपन के यौन वर्गीकरण के दोहराया चक्र और अधिक विलोपन कोशिकाओं को ले जाने की प्रतिदीप्ति आधारित संवर्धन के माध्यम से ड्राइविंग पर आधारित है.

Abstract

Phenotypes for a gene deletion are often revealed only when the mutation is tested in a particular genetic background or environmental condition^1,2. There are examples where many genes need to be deleted to unmask hidden gene functions^3,4. Despite the potential for important discoveries, genetic interactions involving three or more genes are largely unexplored. Exhaustive searches of multi-mutant interactions would be impractical due to the sheer number of possible combinations of deletions. However, studies of selected sets of genes, such as sets of paralogs with a greater a priori chance of sharing a common function, would be informative.

In the yeast Saccharomyces cerevisiae, gene knockout is accomplished by replacing a gene with a selectable marker via homologous recombination. Because the number of markers is limited, methods have been developed for removing and reusing the same marker^5,6,7,8,9,10. However, sequentially engineering multiple mutations using these methods is time-consuming because the time required scales linearly with the number of deletions to be generated.

Here we describe the Green Monster method for routinely engineering multiple deletions in yeast¹¹. In this method, a green fluorescent protein (GFP) reporter integrated into deletions is used to quantitatively label strains according to the number of deletions contained in each strain (Figure 1). Repeated rounds of assortment of GFP-marked deletions via yeast mating and meiosis coupled with flow-cytometric enrichment of strains carrying more of these deletions lead to the accumulation of deletions in strains (Figure 2). Performing multiple processes in parallel, with each process incorporating one or more deletions per round, reduces the time required for strain construction.

The first step is to prepare haploid single-mutants termed ‘ProMonsters,’ each of which carries a GFP reporter in a deleted locus and one of the ‘toolkit’ loci—either Green Monster GMToolkit-a or GMToolkit-α at the can1Δ locus (Figure 3). Using strains from the yeast deletion collection¹², GFP-marked deletions can be conveniently generated by replacing the common KanMX4 cassette existing in these strains with a universal GFP–URA3 fragment. Each GMToolkit contains: either the a– or α-mating-type-specific haploid selection marker¹ and exactly one of the two markers that, when both GMToolkits are present, collectively allow for selection of diploids.

The second step is to carry out the sexual cycling through which deletion loci can be combined within a single cell by the random assortment and/or meiotic recombination that accompanies each cycle of mating and sporulation.

Protocol

1. ProMonsters का सृजन एक 2-GFP मार्कर teto और प्लाज्मिड (एम्पीसिलीन प्रतिरोध) pYOGM012 दृश्यों के साथ प्राइमरों का उपयोग करने से URA3 मार्कर amplifying द्वारा सार्वभौमिक GFP प्रतिस्थापन कैसेट तैयार: GGATCCCCGGGTTAATTAAGG…

Representative Results

When an a-haploid strain carrying four GFP-marked deletions (ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ) was crossed with an α-haploid strain carrying four deletions (ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ), with two deletions (ycl033cΔ yer042wΔ) shared by two strains, a representative result was obtained. The mating mixture was cultured in YPDA medium containing G418 and Nat to select diploids. The resulting diploids were…

Discussion

जैसा कि हम ग्रीन दानव दृष्टिकोण विकसित की है, हम अलग GFP प्रतिस्थापन कैसेट के बीच पुनर्संयोजन की संभावना के साथ संबंध रहे थे, जिससे जीनोम पुनर्व्यवस्था. इस संभावना के खिलाफ Mitigating कोशिकाओं है कि सफलतापूर्व…

Materials

Name of the reagent or instrument	Company	Catalogue number	Comments (optional)
G418	Sigma-Aldrich	A1720	Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 200 mg/ml. Store at 4 °C.
ClonNAT (nourseothricin)	WERNER BioAgents	5001000	Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 100 mg/ml. Store at 4 °C.
Doxycycline	Sigma-Aldrich	D9891	Dissolve in 50% ethanol and filter-sterilize (0.2-μm filter). Stock concentration: 10 mg/ml. Make fresh every four weeks. Shield from light using aluminum foil and store at 4 °C.
Zymolyase	ZymoResearch	E1005
Difco yeast nitrogen base w/o amino acids	BD	291940
Revolver (rotator for tubes)	Labnet	H5600
Enduro Gel XL electrophoresis unit	Labnet	E0160
Sonifier 450	Branson	101-063-198
Microtip for Sonifier 450	Branson	101-148-062
FACSAria cell sorter	BD
MoFlo cell sorter	Beckman-Coulter
Biomek FX or equivalent robot	Beckman Coulter		Optional. For setting up genotyping PCRs.