Transsynaptique génétique conditionnelle traçage dans le cerveau embryonnaire de souris
Summary
Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution.
Abstract
Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits during embryonic maturation of the brain however is technically challenging because most transsynaptic tracing methods developed to date depend on stereotaxic tracer injection. To overcome this problem, we developed a binary genetic strategy for conditional genetic transsynaptic tracing in the mouse brain. Towards this end we generated two complementary knock-in mouse strains to selectively express the bidirectional transsynaptic tracer barley lectin (BL) and the retrograde transsynaptic tracer Tetanus Toxin fragment C from the ROSA26 locus after Cre-mediated recombination. Cell-specific tracer production in these mice is genetically encoded and does not depend on mechanical tracer injection. Therefore our experimental approach is suitable to study neural circuit formation in the embryonic murine brain. Furthermore, because tracer transfer across synapses depends on synaptic activity, these mouse strains can be used to analyze the communication between genetically defined neuronal populations during brain development at a single cell resolution. Here we provide a detailed protocol for transsynaptic tracing in mouse embryos using the novel recombinant ROSA26 alleles. We have utilized this experimental technique in order to delineate the neural circuitry underlying maturation of the reproductive axis in the developing female mouse brain.
Introduction
Chemin tracé anatomique est l'un des outils les plus couramment utilisés pour déchiffrer la relation entre le cerveau et le comportement 1. Progrès dans les technologies de circuits neuronaux traçage a accordé neuroscientifiques avec la capacité de retracer les circuits neuronaux de populations de neurones génétiquement identifiés chez la souris deux. En dépit de ces progrès techniques, il reste difficile de démêler la formation des circuits neuronaux en particulier pendant la maturation embryonnaire. Ce est parce que la plupart des méthodes de traçage développées à ce jour sont basées sur l'injection de traceurs transsynaptique stéréotaxique ou des virus neurotropes génétiquement modifiés (Figure 1) 2,3. Bien que ces techniques d'atteindre la résolution spatiale et temporelle de la connectivité, plusieurs limitations inhérentes telles que les injections traçantes techniquement difficiles dans le cerveau en développement, la reproductibilité du point d'injection, inflammation au potentiel du point d'injection et le plus imporcytotoxicité tantly causée par des virus neurotropes limiter leur utilisation 4.
Une méthode alternative consiste à exprimer que les traceurs transsynaptique transgènes dans des souris génétiquement modifiées. Nous avons récemment modifié cette technique et développé un système binaire de transsynaptique génétique traçage de cartographier les circuits neuronaux de toute population neuronale génétiquement identifié cinq. Notre stratégie expérimentale est basée sur deux nouvelles souches de souris knock-in, qui expriment soit la bidirectionnel traceur orge lectine (BL) 6 ou le traceur rétrograde toxine tétanique fragment C fusionnée à la GFP (GTT) 7 à partir du locus ROSA 26 après à médiation par Cre recombinaison. Ici, nous avons utilisé ces souches de souris pour exprimer sélectivement et BL GTT dans les neurones qui produisent kisspeptin, un neuropeptide qui est impliquée dans la régulation de la maturation de l'axe de reproduction 8,9. Nous démontrons que cette technique est apte à visualiser le développement et la maturation des bisoucircuits neuronaux peptine pendant le développement embryonnaire du cerveau de la souris femelle 5.
Stratégie d'élevage
Le R26-BL-IRES-τlacZ (BIZ) et les R26-GFP-TTC (GTT) lignes de traçage sont knock-in 5 souches qui portent allèles ROSA26 recombinantes. La R26-BIZ et les allèles R26-GTT sont transcriptionnellement silencieux en raison de la présence d'un signal d'arrêt de transcription fort, qui est flanquée par deux sites loxP 5. L'expression du transgène et BIZ GTT est activé par l'élimination médiée par Cre du signal d'arrêt de la transcription. Les allèles R26 et R26-BIZ-GTT peuvent être utilisés indépendamment par simple croisement avec une ligne de pilote Cre. Pour les animaux d'analyse hétérozygotes pour les allèles Cre et R26 respectifs peuvent être utilisés. Chiens d'un souche portant un allèle Cre ou une R26, respectivement, devraient être utilisés comme témoins. En variante, il est également possible de générer des triple knock-in animaux porteurs des allèles Cre, R26 et R26-BIZ-GTT, mais cela nécessitera une croix supplémentaire.
Protocol
Representative Results
Discussion
Exprimant traceurs transsynaptique comme transgènes pour tracer les circuits neuronaux de populations neuronales génétiquement définies présente plusieurs avantages par rapport à l'injection stéréotaxique de traceurs ou des virus neurotopic. Tout d'abord, le traceur est produit comme une protéine endogène et donc ne provoque pas de réponse immunitaire et une voie neuronale sélective peut être analysé en différents animaux avec une reproductibilité élevée. Deuxièmement, parce que ce est un proc…
Divulgazioni
The authors have nothing to disclose.
Acknowledgements
We thank Michael Candlish for critical comments on the manuscript. This project was supported by the Deutsche Forschungsgemeinschaft grants BO1743/6 and SFB/TRR 152 P11 and Z02 to Ulrich Boehm.
Materials
| Name of Material/ Equipment | Company | Catalog Number | Comments/Description |
| Bisbenzimide (Hoechst 33258 dye) | Sigma | 14530-100MG | |
| Ethanol | Sigma | 32205-1L | |
| Cryo mold (Peel-a-way) | Polyscience Inc. | 18646A-1 | 22mm x 22mm x 20mm |
| DMSO | Sigma | D8418-100ML | |
| Dimethyl Formamide (DMF) | VWR Chemicals | 23470,293 | |
| EGTA | ROTH | 3054.3 | |
| Fluoromount G | Southern Biotech | 0100-01 | |
| Glutaraldehyde | Sigma | G5882-50ML | |
| Hydrogen peroxide | Sigma | 34988-7 | |
| Isopentane (Methyl 2-butane) | Sigma | M32631-2.5L | |
| Kaiser's Glycine gelatin | Merck | 1092420100 | |
| Methanol | Sigma | 494437-1L | |
| MgCl2 | Sigma | M2670-100G | |
| NaCl | ROTH | HN00.2 | |
| NBT | Sigma | 298-83-9 | |
| Nonidet P40 substitute | Fluka | 743.85 | |
| OCT | Leica | 14020108926 | |
| PAP pen | Dako | S2002 | |
| Parafarmaldehyde | Sigma | P6148-1KG | |
| Sodium deoxycholate | Sigma | D6750-25G | |
| Sucrose | Sigma | S7903-1KG | |
| Superfrost slides | Thermo Scientific | FT4981GLPLUS | |
| TSA kit | PerkinElmer | NEL700 | |
| TSA plus kit | PerkinElmer | NEL749A001KT | |
| Tris | ROTH | AE15.2 | |
| Triton-X 100 | ROTH | 3051.2 | |
| Tween 20 | ROTH | 9127.1 | |
| X-gal | ROTH | 2315.1 | |
| Cryostat | Leica | na | |
| Light microscope equipped with DIC imaging | Zeiss | Axioskop2 equipped with Axio Vision software | |
| Fluroscence microscope | Zeiss | Axioskop2 equipped with Axio Vision software | |
| Photoshop | Adobe | PS6 | |
| Goat anti-WGA (recognizes BL) | Vector Laboatories | AS-2024 | |
| Biotinylayted horse anti-goat IgG | Vector Laboatories | BA-9500 | |
| Biotinylated goat anti-rabbit IgG | Vector Laboatories | BA-1000 | |
| Rabbit anti-GFP (recognizes GTT) | Invitrogen | A11122 | |
| Rabbit anti-GnRH | Affinity Bio Reagent | PA1-121 | |
| Dylight488-donkey anti-rabbit IgG | Thermo Scientific | SA5-10038 | |
| SA-Alexa Fluor 546 | Life Technologies | S-11225 | |
| Primers | |||
| BL Fwd (for BIZ genotyping) | Eurofins MWG Operon | ATGAAGATGATGAGCACCAG GGC |
|
| BL Rev (for BIZ genotyping) | Eurofins MWG Operon | AGCCCTCGCCGCAGAACTC | |
| Cre Fwd (for Cre genotyping) | Eurofins MWG Operon | GTCGATGCAACGAGTGATGAG GTTCG |
|
| Cre Rev (for Cre genotyping) | Eurofins MWG Operon | CCAGGCTAAGTGCCTTCTCTAC ACCTGC |
|
| TTC Fwd (for GTT genotyping) | Eurofins MWG Operon | AGCAAGGGCGAGGAGCTGTT | |
| TTC Rev (for GTT genotyping) | Eurofins MWG Operon | GTCTTGTAGTTGCCGTCGTCCT TGAA |
|
| XY Fwd (for gender genotyping) | Eurofins MWG Operon | TGAAGCTTTTGGCTTTGA | |
| XY Rev (for gender genotyping) | Eurofins MWG Operon | CCGCTGCCAAATTCTTTG | |
| ROSA26 Fwd | Eurofins MWG Operon | CGAAGTCGCTCTGAGTTGTTATC | |
| ROSA26 Rev | Eurofins MWG Operon | GCAGATGGAGCGGGAGAAAT | |
| SA Rev | Eurofins MWG Operon | CGAAGTCGCTCTGAGTTGTTATC | |
Riferimenti
- Vercelli, A., Repici, M., Garbossa, D., Grimaldi, A. Recent techniques for tracing pathways in the central nervous system of developing and adult mammals. Brain. Res. Bull. 51, 11-28 (2000).
- Huang, Z. J., Zeng, H. Genetic approaches to neural circuits in the mouse. Annu. Rev. Neurosci. 36, 183-215 (2013).
- Lanciego, J. L., Wouterlood, F. G. A half century of experimental neuroanatomical tracing. J. Chem. Neuroanat. 42, 157-183 (2011).
- DeFalco, J., et al. Virus-assisted mapping of neural inputs to a feeding center in the hypothalamus. Science. 291, 2608-2613 (2001).
- Kumar, D., et al. Murine arcuate nucleus kisspeptin neurons communicate with GnRH neurons in utero. J. Neurosci. 34, 3756-3766 (2014).
- Horowitz, L. F., Montmayeur, J. P., Echelard, Y., Buck, L. B. A genetic approach to trace neural circuits. Proc. Natl. Acad. Sci. U.S.A. 96, 3194-3199 (1999).
- Maskos, U., Kissa, K., ST Cloment, C., Brulet, P. Retrograde trans-synaptic transfer of green fluorescent protein allows the genetic mapping of neuronal circuits in transgenic mice. Proc. Natl. Acad. Sci. U.S.A. 99, 10120-10125 (2002).
- De Roux, N., et al. Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54. Proc. Natl. Acad. Sci. U.S.A. 100, 10972-10976 (2003).
- Seminara, S. B., et al. The GPR54 gene as a regulator of puberty. N. Engl. J. Med. 349, 1614-1627 (2003).
- Mayer, C., et al. Timing and completion of puberty in female mice depend on estrogen receptor alpha-signaling in kisspeptin neurons. Proc. Natl. Acad. Sci. U.S.A. 107, 22693-22698 (2010).
- Soriano, P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat. Genet. 21, 70-71 (1999).
- Seibler, J., et al. Single copy shRNA configuration for ubiquitous gene knockdown in mice. Nucleic Acids Res. 33, e67 (2005).
- Semaan, S. J., Kauffman, A. S. Emerging concepts on the epigenetic and transcriptional regulation of the Kiss1 gene. Int. J. Dev. Neurosci. 31, 452-462 (2013).
- Feil, R., et al. Ligand-activated site-specific recombination in mice. Proc. Natl. Acad. Sci. U.S.A. 93, 10887-10890 (1996).
