Условный Генетическая Transsynaptic Трассировка в мозге эмбриональных мыши
Summary
Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution.
Abstract
Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits during embryonic maturation of the brain however is technically challenging because most transsynaptic tracing methods developed to date depend on stereotaxic tracer injection. To overcome this problem, we developed a binary genetic strategy for conditional genetic transsynaptic tracing in the mouse brain. Towards this end we generated two complementary knock-in mouse strains to selectively express the bidirectional transsynaptic tracer barley lectin (BL) and the retrograde transsynaptic tracer Tetanus Toxin fragment C from the ROSA26 locus after Cre-mediated recombination. Cell-specific tracer production in these mice is genetically encoded and does not depend on mechanical tracer injection. Therefore our experimental approach is suitable to study neural circuit formation in the embryonic murine brain. Furthermore, because tracer transfer across synapses depends on synaptic activity, these mouse strains can be used to analyze the communication between genetically defined neuronal populations during brain development at a single cell resolution. Here we provide a detailed protocol for transsynaptic tracing in mouse embryos using the novel recombinant ROSA26 alleles. We have utilized this experimental technique in order to delineate the neural circuitry underlying maturation of the reproductive axis in the developing female mouse brain.
Introduction
Трассировка Анатомический путь является одним из наиболее часто используемых инструментов, чтобы расшифровать связь между мозгом и поведением 1. Продвижение в нейронных цепей отслеживания технологий даровал неврологов с возможностью отслеживания нейронных цепей из генетически определенных популяций нейронов у мышей 2. Несмотря на эти технические достижения остается сложной, чтобы разгадать образование нейронных цепей, особенно во время эмбрионального созревания. Это потому, что большинство методов отслеживания разработанных к настоящему основаны на стереотаксической инъекции transsynaptic индикаторов или генетически модифицированных нейротропных вирусов (рис 1) 2,3. Хотя эти методы достижения пространственного и временного разрешения подключения, присущие существенные ограничения, такие как технически сложных трассирующих вливаний в развивающемся мозге, воспроизводимость в месте инъекции, потенциал воспаление в месте инъекции и наиболее важtantly цитотоксичность вызвано нейротропных вирусов ограничить их использование 4.
Альтернативный метод заключается в выражении transsynaptic индикаторов, как трансгенов в генетически измененных мышей. Мы недавно изменили эту технику и разработали двойную систему отслеживания генетических transsynaptic для отображения нейронных цепей любого генетически определенных нейронов населения 5. Наши экспериментальные стратегия основана на двух новых нокаут в линиях мышей, которые выражают либо двунаправленный Tracer ячменя лектин (BL) 6 или ретроградная Tracer столбнячный токсин фрагмента C слит с GFP (GTT) 7 из ROSA 26 локуса после Cre-опосредованного рекомбинация. Здесь мы использовали эти штаммы мыши, чтобы выборочно выразить BL и GTT в нейронах, которые производят kisspeptin, нейропептид, который участвует в регуляции созревания репродуктивной оси 8,9. Мы показываем, что этот метод подходит для визуализации развитие и созревание поцелуяпептин нейронная схема во время эмбрионального развития женского мозга мыши 5.
Стратегия Разведение
R26-BL-IRES-τlacZ (BIZ) и R26-GFP-ТТЦ (GTT) трассирующие линии плей-штаммов 5, которые несут рекомбинантные аллелей ROSA26. R26-BIZ и аллели R26-GTT транскрипционно молчание в связи с наличием сильного транскрипции стоп-сигнала, который в сопровождении двух LoxP сайтов 5. Выражение бизнесе и GTT трансгена активируется с помощью Cre-опосредованного удалени транскрипции стоп-сигналом. Аллели R26-BIZ и R26-GTT может использоваться самостоятельно, просто пересечения с линией водителя CRE. Для анализа животных, гетерозиготных по соответствующим Cre и R26 аллели могут быть использованы. Однопомётники несущие один Cre или один R26 аллель, соответственно, должны быть использованы в качестве контрольных. В качестве альтернативы, также возможно, чтобы генерировать тriple стучать в животных, несущих аллели Cre, R26-Biz и R26-ГЦГ, однако это потребует еще один крест.
Protocol
Representative Results
Discussion
Выражая transsynaptic индикаторов, как трансгенов проследить нейронных цепей генетически определенных популяций нейронов имеет ряд преимуществ по сравнению с стереотаксической инъекции индикаторов или NEUROTOPIC вирусов. Во-первых, трассировщик получают в качестве эндогенного белка и, следов?…
Divulgazioni
The authors have nothing to disclose.
Acknowledgements
We thank Michael Candlish for critical comments on the manuscript. This project was supported by the Deutsche Forschungsgemeinschaft grants BO1743/6 and SFB/TRR 152 P11 and Z02 to Ulrich Boehm.
Materials
| Name of Material/ Equipment | Company | Catalog Number | Comments/Description |
| Bisbenzimide (Hoechst 33258 dye) | Sigma | 14530-100MG | |
| Ethanol | Sigma | 32205-1L | |
| Cryo mold (Peel-a-way) | Polyscience Inc. | 18646A-1 | 22mm x 22mm x 20mm |
| DMSO | Sigma | D8418-100ML | |
| Dimethyl Formamide (DMF) | VWR Chemicals | 23470,293 | |
| EGTA | ROTH | 3054.3 | |
| Fluoromount G | Southern Biotech | 0100-01 | |
| Glutaraldehyde | Sigma | G5882-50ML | |
| Hydrogen peroxide | Sigma | 34988-7 | |
| Isopentane (Methyl 2-butane) | Sigma | M32631-2.5L | |
| Kaiser's Glycine gelatin | Merck | 1092420100 | |
| Methanol | Sigma | 494437-1L | |
| MgCl2 | Sigma | M2670-100G | |
| NaCl | ROTH | HN00.2 | |
| NBT | Sigma | 298-83-9 | |
| Nonidet P40 substitute | Fluka | 743.85 | |
| OCT | Leica | 14020108926 | |
| PAP pen | Dako | S2002 | |
| Parafarmaldehyde | Sigma | P6148-1KG | |
| Sodium deoxycholate | Sigma | D6750-25G | |
| Sucrose | Sigma | S7903-1KG | |
| Superfrost slides | Thermo Scientific | FT4981GLPLUS | |
| TSA kit | PerkinElmer | NEL700 | |
| TSA plus kit | PerkinElmer | NEL749A001KT | |
| Tris | ROTH | AE15.2 | |
| Triton-X 100 | ROTH | 3051.2 | |
| Tween 20 | ROTH | 9127.1 | |
| X-gal | ROTH | 2315.1 | |
| Cryostat | Leica | na | |
| Light microscope equipped with DIC imaging | Zeiss | Axioskop2 equipped with Axio Vision software | |
| Fluroscence microscope | Zeiss | Axioskop2 equipped with Axio Vision software | |
| Photoshop | Adobe | PS6 | |
| Goat anti-WGA (recognizes BL) | Vector Laboatories | AS-2024 | |
| Biotinylayted horse anti-goat IgG | Vector Laboatories | BA-9500 | |
| Biotinylated goat anti-rabbit IgG | Vector Laboatories | BA-1000 | |
| Rabbit anti-GFP (recognizes GTT) | Invitrogen | A11122 | |
| Rabbit anti-GnRH | Affinity Bio Reagent | PA1-121 | |
| Dylight488-donkey anti-rabbit IgG | Thermo Scientific | SA5-10038 | |
| SA-Alexa Fluor 546 | Life Technologies | S-11225 | |
| Primers | |||
| BL Fwd (for BIZ genotyping) | Eurofins MWG Operon | ATGAAGATGATGAGCACCAG GGC |
|
| BL Rev (for BIZ genotyping) | Eurofins MWG Operon | AGCCCTCGCCGCAGAACTC | |
| Cre Fwd (for Cre genotyping) | Eurofins MWG Operon | GTCGATGCAACGAGTGATGAG GTTCG |
|
| Cre Rev (for Cre genotyping) | Eurofins MWG Operon | CCAGGCTAAGTGCCTTCTCTAC ACCTGC |
|
| TTC Fwd (for GTT genotyping) | Eurofins MWG Operon | AGCAAGGGCGAGGAGCTGTT | |
| TTC Rev (for GTT genotyping) | Eurofins MWG Operon | GTCTTGTAGTTGCCGTCGTCCT TGAA |
|
| XY Fwd (for gender genotyping) | Eurofins MWG Operon | TGAAGCTTTTGGCTTTGA | |
| XY Rev (for gender genotyping) | Eurofins MWG Operon | CCGCTGCCAAATTCTTTG | |
| ROSA26 Fwd | Eurofins MWG Operon | CGAAGTCGCTCTGAGTTGTTATC | |
| ROSA26 Rev | Eurofins MWG Operon | GCAGATGGAGCGGGAGAAAT | |
| SA Rev | Eurofins MWG Operon | CGAAGTCGCTCTGAGTTGTTATC | |
Riferimenti
- Vercelli, A., Repici, M., Garbossa, D., Grimaldi, A. Recent techniques for tracing pathways in the central nervous system of developing and adult mammals. Brain. Res. Bull. 51, 11-28 (2000).
- Huang, Z. J., Zeng, H. Genetic approaches to neural circuits in the mouse. Annu. Rev. Neurosci. 36, 183-215 (2013).
- Lanciego, J. L., Wouterlood, F. G. A half century of experimental neuroanatomical tracing. J. Chem. Neuroanat. 42, 157-183 (2011).
- DeFalco, J., et al. Virus-assisted mapping of neural inputs to a feeding center in the hypothalamus. Science. 291, 2608-2613 (2001).
- Kumar, D., et al. Murine arcuate nucleus kisspeptin neurons communicate with GnRH neurons in utero. J. Neurosci. 34, 3756-3766 (2014).
- Horowitz, L. F., Montmayeur, J. P., Echelard, Y., Buck, L. B. A genetic approach to trace neural circuits. Proc. Natl. Acad. Sci. U.S.A. 96, 3194-3199 (1999).
- Maskos, U., Kissa, K., ST Cloment, C., Brulet, P. Retrograde trans-synaptic transfer of green fluorescent protein allows the genetic mapping of neuronal circuits in transgenic mice. Proc. Natl. Acad. Sci. U.S.A. 99, 10120-10125 (2002).
- De Roux, N., et al. Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54. Proc. Natl. Acad. Sci. U.S.A. 100, 10972-10976 (2003).
- Seminara, S. B., et al. The GPR54 gene as a regulator of puberty. N. Engl. J. Med. 349, 1614-1627 (2003).
- Mayer, C., et al. Timing and completion of puberty in female mice depend on estrogen receptor alpha-signaling in kisspeptin neurons. Proc. Natl. Acad. Sci. U.S.A. 107, 22693-22698 (2010).
- Soriano, P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat. Genet. 21, 70-71 (1999).
- Seibler, J., et al. Single copy shRNA configuration for ubiquitous gene knockdown in mice. Nucleic Acids Res. 33, e67 (2005).
- Semaan, S. J., Kauffman, A. S. Emerging concepts on the epigenetic and transcriptional regulation of the Kiss1 gene. Int. J. Dev. Neurosci. 31, 452-462 (2013).
- Feil, R., et al. Ligand-activated site-specific recombination in mice. Proc. Natl. Acad. Sci. U.S.A. 93, 10887-10890 (1996).
