Villkorlig Genetisk transsynaptisk Tracing i embryonal Mouse Brain
Summary
Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution.
Abstract
Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits during embryonic maturation of the brain however is technically challenging because most transsynaptic tracing methods developed to date depend on stereotaxic tracer injection. To overcome this problem, we developed a binary genetic strategy for conditional genetic transsynaptic tracing in the mouse brain. Towards this end we generated two complementary knock-in mouse strains to selectively express the bidirectional transsynaptic tracer barley lectin (BL) and the retrograde transsynaptic tracer Tetanus Toxin fragment C from the ROSA26 locus after Cre-mediated recombination. Cell-specific tracer production in these mice is genetically encoded and does not depend on mechanical tracer injection. Therefore our experimental approach is suitable to study neural circuit formation in the embryonic murine brain. Furthermore, because tracer transfer across synapses depends on synaptic activity, these mouse strains can be used to analyze the communication between genetically defined neuronal populations during brain development at a single cell resolution. Here we provide a detailed protocol for transsynaptic tracing in mouse embryos using the novel recombinant ROSA26 alleles. We have utilized this experimental technique in order to delineate the neural circuitry underlying maturation of the reproductive axis in the developing female mouse brain.
Introduction
Anatomisk bana spårning är en av de mest vanligen använda verktyg för att dechiffrera förhållandet mellan hjärnan och beteende 1. Avancemang inom neurala krets spåra teknik har skänkt neuroforskare med förmågan att spåra nervbanor från genetiskt identifierade neuron populationer i möss 2. Trots dessa tekniska framsteg det förblir utmanande att riva upp bildandet av neurala kretsar särskilt under embryonala mognad. Detta beror på att de flesta av de spårnings metoder som utvecklats hittills är baserade på stereotaxisk injektion av transsynaptisk spårämnen eller genetiskt modifierade neurotropa virus (Figur 1) 2,3. Även om dessa tekniker uppnår rumslig och tidsmässig upplösning av anslutningsmöjligheter, flera inneboende begränsningar såsom tekniskt utmanande spår injektioner i den växande hjärnan, reproducerbarhet injektions, potentiella inflammation vid injektionsstället och mest viktantly cytotoxicitet orsakad av neurotropa virus begränsa deras användning 4.
En alternativ metod är att uttrycka de transsynaptisk spårämnen som transgener i genetiskt förändrade möss. Vi har nyligen ändrat denna teknik och utvecklat en binär genetiskt transsynaptisk spåra system för att kartlägga de nervbanor i alla genetiskt identifierade neuronala befolkningen 5. Vår experimentella strategi bygger på två nya knock-in mus stammar, som uttrycker antingen den dubbelriktade tracer korn lektin (BL) 6 eller bakåtsträvande spårämne tetanustoxin fragment C smält till GFP (GTT) 7 från ROSA 26 locus efter Cre-medierad rekombination. Här har vi använt dessa musstammar att selektivt uttrycka BL och GTT i nervceller som producerar Kisspeptin, en neuropeptid som är inblandad i regleringen mognaden av reproduktiva axeln 8,9. Vi visar att denna teknik är lämplig för att visualisera utvecklingen och mognaden av kysspeptin neurala kretsar under fosterutvecklingen av den kvinnliga musen hjärnan 5.
Avelsstrategi
Den K26-BL-IRES-τlacZ (BIZ) och K26-GFP-TTC (GTT) spårlinjer är knock-i stammar 5 som bär rekombinanta ROSA26 alleler. Den R26-BIZ och R26-GTT alleler är transkriptionellt tyst på grund av närvaron av en stark transkriptionsstoppsignal, som flankeras av två loxP-ställen 5. Uttryck av BIZ och GTT transgen aktiveras av Cre-medierad avlägsnande av transkriptionsstoppsignalen. De K26-BIZ och R26-GTT alleler kan användas oberoende genom att helt enkelt korsa med en Cre förare linje. För analysdjur heterozygot för respektive Cre och R26 alleler kan användas. Kull bär en Cre eller en R26-allel, respektive, bör användas som kontroller. Alternativt är det också möjligt att alstra triple knock-in djur som bär på Cre, R26-BIZ och R26-GTT alleler, men detta kommer att kräva ytterligare en kors.
Protocol
Representative Results
Discussion
Att uttrycka transsynaptisk spårämnen som transgener för att spåra de nervbanor av genetiskt definierade neuronala populationer har flera fördelar jämfört med stereotaktisk injektion av spårämnen eller neurotopic virus. Först tracern produceras som ett endogent protein och därför inte framkallar någon immunrespons och en selektiv nervbana kan analyseras i olika djur med hög reproducerbarhet. För det andra, eftersom detta är en icke-invasiv metod kan användas för att spåra kretsarna från nervceller in…
Divulgazioni
The authors have nothing to disclose.
Acknowledgements
We thank Michael Candlish for critical comments on the manuscript. This project was supported by the Deutsche Forschungsgemeinschaft grants BO1743/6 and SFB/TRR 152 P11 and Z02 to Ulrich Boehm.
Materials
| Name of Material/ Equipment | Company | Catalog Number | Comments/Description |
| Bisbenzimide (Hoechst 33258 dye) | Sigma | 14530-100MG | |
| Ethanol | Sigma | 32205-1L | |
| Cryo mold (Peel-a-way) | Polyscience Inc. | 18646A-1 | 22mm x 22mm x 20mm |
| DMSO | Sigma | D8418-100ML | |
| Dimethyl Formamide (DMF) | VWR Chemicals | 23470,293 | |
| EGTA | ROTH | 3054.3 | |
| Fluoromount G | Southern Biotech | 0100-01 | |
| Glutaraldehyde | Sigma | G5882-50ML | |
| Hydrogen peroxide | Sigma | 34988-7 | |
| Isopentane (Methyl 2-butane) | Sigma | M32631-2.5L | |
| Kaiser's Glycine gelatin | Merck | 1092420100 | |
| Methanol | Sigma | 494437-1L | |
| MgCl2 | Sigma | M2670-100G | |
| NaCl | ROTH | HN00.2 | |
| NBT | Sigma | 298-83-9 | |
| Nonidet P40 substitute | Fluka | 743.85 | |
| OCT | Leica | 14020108926 | |
| PAP pen | Dako | S2002 | |
| Parafarmaldehyde | Sigma | P6148-1KG | |
| Sodium deoxycholate | Sigma | D6750-25G | |
| Sucrose | Sigma | S7903-1KG | |
| Superfrost slides | Thermo Scientific | FT4981GLPLUS | |
| TSA kit | PerkinElmer | NEL700 | |
| TSA plus kit | PerkinElmer | NEL749A001KT | |
| Tris | ROTH | AE15.2 | |
| Triton-X 100 | ROTH | 3051.2 | |
| Tween 20 | ROTH | 9127.1 | |
| X-gal | ROTH | 2315.1 | |
| Cryostat | Leica | na | |
| Light microscope equipped with DIC imaging | Zeiss | Axioskop2 equipped with Axio Vision software | |
| Fluroscence microscope | Zeiss | Axioskop2 equipped with Axio Vision software | |
| Photoshop | Adobe | PS6 | |
| Goat anti-WGA (recognizes BL) | Vector Laboatories | AS-2024 | |
| Biotinylayted horse anti-goat IgG | Vector Laboatories | BA-9500 | |
| Biotinylated goat anti-rabbit IgG | Vector Laboatories | BA-1000 | |
| Rabbit anti-GFP (recognizes GTT) | Invitrogen | A11122 | |
| Rabbit anti-GnRH | Affinity Bio Reagent | PA1-121 | |
| Dylight488-donkey anti-rabbit IgG | Thermo Scientific | SA5-10038 | |
| SA-Alexa Fluor 546 | Life Technologies | S-11225 | |
| Primers | |||
| BL Fwd (for BIZ genotyping) | Eurofins MWG Operon | ATGAAGATGATGAGCACCAG GGC |
|
| BL Rev (for BIZ genotyping) | Eurofins MWG Operon | AGCCCTCGCCGCAGAACTC | |
| Cre Fwd (for Cre genotyping) | Eurofins MWG Operon | GTCGATGCAACGAGTGATGAG GTTCG |
|
| Cre Rev (for Cre genotyping) | Eurofins MWG Operon | CCAGGCTAAGTGCCTTCTCTAC ACCTGC |
|
| TTC Fwd (for GTT genotyping) | Eurofins MWG Operon | AGCAAGGGCGAGGAGCTGTT | |
| TTC Rev (for GTT genotyping) | Eurofins MWG Operon | GTCTTGTAGTTGCCGTCGTCCT TGAA |
|
| XY Fwd (for gender genotyping) | Eurofins MWG Operon | TGAAGCTTTTGGCTTTGA | |
| XY Rev (for gender genotyping) | Eurofins MWG Operon | CCGCTGCCAAATTCTTTG | |
| ROSA26 Fwd | Eurofins MWG Operon | CGAAGTCGCTCTGAGTTGTTATC | |
| ROSA26 Rev | Eurofins MWG Operon | GCAGATGGAGCGGGAGAAAT | |
| SA Rev | Eurofins MWG Operon | CGAAGTCGCTCTGAGTTGTTATC | |
Riferimenti
- Vercelli, A., Repici, M., Garbossa, D., Grimaldi, A. Recent techniques for tracing pathways in the central nervous system of developing and adult mammals. Brain. Res. Bull. 51, 11-28 (2000).
- Huang, Z. J., Zeng, H. Genetic approaches to neural circuits in the mouse. Annu. Rev. Neurosci. 36, 183-215 (2013).
- Lanciego, J. L., Wouterlood, F. G. A half century of experimental neuroanatomical tracing. J. Chem. Neuroanat. 42, 157-183 (2011).
- DeFalco, J., et al. Virus-assisted mapping of neural inputs to a feeding center in the hypothalamus. Science. 291, 2608-2613 (2001).
- Kumar, D., et al. Murine arcuate nucleus kisspeptin neurons communicate with GnRH neurons in utero. J. Neurosci. 34, 3756-3766 (2014).
- Horowitz, L. F., Montmayeur, J. P., Echelard, Y., Buck, L. B. A genetic approach to trace neural circuits. Proc. Natl. Acad. Sci. U.S.A. 96, 3194-3199 (1999).
- Maskos, U., Kissa, K., ST Cloment, C., Brulet, P. Retrograde trans-synaptic transfer of green fluorescent protein allows the genetic mapping of neuronal circuits in transgenic mice. Proc. Natl. Acad. Sci. U.S.A. 99, 10120-10125 (2002).
- De Roux, N., et al. Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54. Proc. Natl. Acad. Sci. U.S.A. 100, 10972-10976 (2003).
- Seminara, S. B., et al. The GPR54 gene as a regulator of puberty. N. Engl. J. Med. 349, 1614-1627 (2003).
- Mayer, C., et al. Timing and completion of puberty in female mice depend on estrogen receptor alpha-signaling in kisspeptin neurons. Proc. Natl. Acad. Sci. U.S.A. 107, 22693-22698 (2010).
- Soriano, P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat. Genet. 21, 70-71 (1999).
- Seibler, J., et al. Single copy shRNA configuration for ubiquitous gene knockdown in mice. Nucleic Acids Res. 33, e67 (2005).
- Semaan, S. J., Kauffman, A. S. Emerging concepts on the epigenetic and transcriptional regulation of the Kiss1 gene. Int. J. Dev. Neurosci. 31, 452-462 (2013).
- Feil, R., et al. Ligand-activated site-specific recombination in mice. Proc. Natl. Acad. Sci. U.S.A. 93, 10887-10890 (1996).
