Murine Colonic म्यूकोसा के microdissection के लिए Cryosectioning विधि
Summary
Here we describe a simple method for the isolation of spatially distinct murine colonic epithelial surface cells from the underlying crypt-base cells.
Abstract
The colonic mucosal tissue provides a vital barrier to luminal antigens. This barrier is composed of a monolayer of simple columnar epithelial cells. The colonic epithelium is dynamically turned over and epithelial cells are generated in the stem cell containing crypts of Lieberkühn. Progenitor cells produced in the crypt-bases migrate toward the luminal surface, undergoing a process of cellular differentiation before being shed into the gut lumen. In order to study these processes at the molecular level, we have developed a simple method for the microdissection of two spatially distinct regions of the colonic mucosa; the proliferative crypt zone, and the differentiated surface epithelial cells. Our objective is to isolate specific crypt and surface epithelial cell populations from mouse colonic mucosa for the isolation of RNA and protein.
Introduction
colonic उपकला अस्तर निवासी स्टेम कोशिकाओं को हर कुछ दिन 1 ऊतक भरपाई के साथ एक उच्च पुनर्योजी ऊतक है। उत्थान की यह प्रक्रिया एक प्रफलन स्टेम सेल डिब्बे के रखरखाव की आवश्यकता है। समय के साथ, नव निर्मित बेटी कोशिकाओं को उनके proliferative संभावित खो देते हैं और आंत की luminal सतह की ओर पलायन। माइग्रेशन साथ संपाती, मूल कोशिकाओं परिपक्व बाधा के गठन enterocytes या श्लेष्मा उत्पादन जाम कोशिकाओं में अंतर। इस भेदभाव कार्यक्रम की विफलता इस तरह के भड़काऊ आंत्र रोग और पेट के कैंसर 2,3 में मनाया जाता है के रूप में उपकला बाधा से समझौता करने के लिए योगदान करने के लिए सोचा है।
इसके बाद के संस्करण प्रक्रियाओं का विस्तृत अध्ययन तहखाना-आधार है और सतह सेल आबादी को अलग करने के लिए तरीके की आवश्यकता होगी। कई तरीकों अद्वितीय फायदे और कमियां के साथ प्रत्येक मौजूद हैं। आंतों उपकला कोशिकाओं के अलगाव के लिए वर्तमान तरीकों चर्चा में शामिलप्रयोगात्मक शर्तों 4,5 पर निर्भर पूरे तहखाने, उपकला शीट, या एकल कक्षों के अलगाव में जिसके परिणामस्वरूप elating एजेंटों और मैकेनिकल विसंघटन। इन उच्च उपज तरीके हैं, अभी तक कहनेवाला संकेतन में परिवर्तन देशी वातावरण 6,7 प्रतिनिधित्व नहीं हो सकता है कि इन परिस्थितियों में सूचना दी गई है। लेजर कब्जा microdissection के स्थानिक अलग सामग्री के संग्रह के लिए अनुमति देता है, लेकिन कम आणविक उपज 8,9 प्राप्त होता है। मानव colonic ऊतक में, धारावाहिक क्षैतिज cryosectioning तरीकों के 10 विकसित किया गया है। हालांकि, murine श्लैष्मिक ऊतकों इस तकनीक का प्रत्यक्ष विनियोग के लिए बेहद छोटे हैं। इंसानों में, पेट में (तहखाना-आधार है और सतह कोशिकाओं के बीच दूर) आंतों तहखाना लंबाई माइक्रोन 100-1,000 ~ के बीच 11 बदलता रहता है। चूहों में, तहखाना लंबाई माइक्रोन 50-300 ~ के बीच (चित्रा 1 ए देखें) कर रहे हैं। murine तहखाने के छोटे आकार इसोला के लिए एक चुनौती प्रस्तुत करता हैमौजूदा प्रोटोकॉल का उपयोग इन दो सेल आबादी के tion।
अब हम एक कम लागत, तहखाना आधार के अलगाव के लिए उच्च उपज विधि का वर्णन और murine colonic ऊतक में उपकला सेल की आबादी की सतह। इस तरह से काटा ऊतक तो immunofluorescence धुंधला, आरटी पीसीआर (रियल टाइम-पोलीमरेज़ चेन रिएक्शन) या पश्चिमी सोख्ता सहित मानक बहाव के अनुप्रयोगों के एक नंबर से विश्लेषण किया जा सकता है।
Protocol
Representative Results
Discussion
colonic उपकला कोशिका प्रसार और भेदभाव में शामिल आणविक तंत्र खराब समझ रहे हैं। इस colonic उपकला तहखाने के आधार पर स्टेम सेल डिब्बे के सेलुलर संकेत पर्यावरण के बारे में हमारी समझ में अंतराल भी शामिल है। Enterocyte भेदभाव कायम करना है कि प्रक्रियाओं में एक बढ़ती रुचि भी है। उदाहरण के लिए, vivo में भेदभाव की समझ में इन विट्रो प्राथमिक आंतों सिस्टम 16 निर्माण करने के उद्देश्य के अध्ययन के लिए एक बेंचमार्क के रूप में की आवश्यकता है वृद्धि हुई है।
उपरोक्त प्रक्रिया अतिरिक्त ध्यान देने की जरूरत है कि कई चरणों में हैं। सबसे पहले, जमे हुए ऊतक खंड के चारों ओर किनारों (धारा 3.2 में चर्चा के रूप में) को हटाने के विच्छेदन और ठंड के दौरान कर्ल ऊतक किनारों के रूप में की आवश्यकता है। इन किनारों परिणामों को स्थानांतरित करने में विफलता सतह और तहखाना आधार कोशिकाओं के एक मिश्रित आबादी है। एक पूर्व ठंडा, समतल अक्टूबर ब्लॉक पर ऊतक बढ़ते भी आवश्यक है। टीउसकी प्रोटोकॉल प्रत्येक पूल में वर्गों की संख्या बदलकर बाहर का बृहदान्त्र के अन्य क्षेत्रों के लिए अनुकूलित किया जा सकता है। चित्रा 1 बी में दिखाया गया है उदाहरण के लिए, श्लैष्मिक तहखाना लंबाई 150-300 माइक्रोन के बीच होती है। गुदा से 4 सेमी-6 सेमी के बीच इस क्षेत्र का अध्ययन इसलिए, जब वर्गों की संख्या महत्वपूर्ण बात यह 30. 15 से वृद्धि की जानी चाहिए, इस प्रोटोकॉल के समीपस्थ पेट के लिए नहीं सुझाव दिया है (7 सेमी-9 सेमी) के कारण सिलवटों को ( धारावाहिक सेक्शनिंग से अलग सतह और तहखाना आधार कोशिकाओं के लिए यह असंभव बना लुमेन में विस्तार जो plicae obliquae)।
सीरियल सेक्शनिंग तकनीक तहखाना आधार का अध्ययन करने और मानव में उपकला सेल आबादी सतह के लिए इस्तेमाल किया गया है। हालांकि, हमारे प्रोटोकॉल की वजह से murine ऊतक के छोटे आकार के लिए आवश्यक हैं कि अतिरिक्त कदम कहते हैं। हम ऊपर प्रोटोकॉल आनुवंशिक रूप से विनयशील माउस प्रणालियों में तहखाना-आधार है और सतह उपकला सेल की आबादी की जांच के लिए अनुमति देगा कि प्रस्ताव। दरअसल, जमा वर्गों Yieएलडी उच्च गुणवत्ता वाले प्रोटीन और आरएनए उपयुक्त बहाव के विश्लेषण। भविष्य अनुप्रयोगों सेल संकेत दे रास्ते या chromatin immunoprecipitation का अध्ययन शामिल हो सकते हैं। हालांकि, यह ऊपर वर्णित वैकल्पिक तरीकों के कई तरह, जिसके परिणामस्वरूप वर्गों उपकला और मध्य लामिना propria कोशिकाओं का एक मिश्रण होते हैं, कि ध्यान दिया जाना चाहिए। अंत में, यहाँ वर्णित प्रोटोकॉल murine colonic mucosa के स्थानिक अलग क्षेत्रों में आणविक प्रक्रियाओं के विश्लेषण के लिए एक तेजी से, उच्च उपज तरीका प्रदान करता है।
Divulgazioni
The authors have nothing to disclose.
Acknowledgements
Supported by National Institutes of Health (DK55679, and DK59888 to A.N.). Emory University Integrated Cellular Imaging Microscopy Core of the Winship Cancer Institute comprehensive cancer center grant, P30CA138292, and the Crohn’s and Colitis Foundation of America Career Development award to C.T.C. and Fellowship Award to A.E.F.
Materials
| Microtome | Leica Biosystems, Nussloch Germany | CM 1510-3 | |
| MyiQ real time PCR detector | BioRad | ||
| LSM 510 | Carl Zeiss | Confocal microscope | |
| Materials | |||
| OCT | Tissue-Tek, Sakura Finetek, Torrance CA | 4583 | |
| cryo-mold | Tissue-Tek, Sakura Finetek, Torrance CA | 4557 | 25mmx20mmx5mm |
| High profile microtome blade | Leica Biosystems, Nussloch germany | 818 | |
| GEM industrial blades | American Safety Razor Blades | 62-0314 | |
| Sylgard silicon elastomere base | Dow Corning, Midland MI | 3097358 | |
| 27 1/2 g needle | Becton-Dickinson, Franklin Lakes, NJ | 305109 | pins for dissection |
| TRizol | Life Technologies | 15596018 | |
| Rneasy | Qiagen | 74104 | |
| DNAse | Qiagen | 79254 | |
| Reagents | |||
| Antibody ZO-1 | Invitrogen | 187430 | |
| Antibody KLF4 | Cell Signaling | 4038S | |
| Antibody mGAPDH | Sigma | G8795 | |
| Antibody Secondary Alexa conjugate | Invitrogen | A11034 | 488 anti-rabbit |
| Antibody Secondary HRP conjugate | Jackson | 111/115-001-003 | rabbit/mouse |
| Topro-3 | Invitrogen | T3605 | |
| HANKs balanced salt buffer | Life Technologies | 14025092 | |
| RIPA lysis buffer | 50mM Tris-HCl pH 7.4 150mM NaCl 1% NP40 0.25% Na-deoxycholate | ||
| PCR Primers | |||
| primer TBP 3' | GGAATTGTACCGCAGCTTCAAA | ||
| primer TBP 5' | GATGACTGCAGCAAATCGCTT | ||
| primer KLF4 3' | TGTGACTATGCAGGCTGTGGCAAA | ||
| primer KLF4 5' | ACAGTGGTAAGGTTTCTCGCCTGT |
Riferimenti
- Noah, T. K., Donahue, B., Shroyer, N. F. Intestinal development and differentiation. Exp Cell Res. 317, 2702-2710 (2011).
- Humphries, A., Wright, N. A. Colonic crypt organization and tumorigenesis. Nat Rev Cancer. 8, 415-424 (2008).
- Weber, C. R., Turner, J. R. Inflammatory bowel disease: is it really just another break in the wall. Gut. 56, 6-8 (2007).
- Bjerknes, M., Cheng, H. Methods for the isolation of intact epithelium from the mouse intestine. Anat Rec. 199, 565-574 (1981).
- Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
- Rand, M. D., et al. Calcium depletion dissociates and activates heterodimeric notch receptors. Mol Cell Biol. 20, 1825-1835 (2000).
- Gjorevski, N., Boghaert, E., Nelson, C. M. Regulation of Epithelial-Mesenchymal Transition by Transmission of Mechanical Stress through Epithelial Tissues. Cancer Microenviron. 5, 29-38 (2012).
- Lechner, S., et al. Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia. Gut. 52, 1148-1153 (2003).
- Reizel, Y., et al. Colon stem cell and crypt dynamics exposed by cell lineage reconstruction. PLoS Genet. 7, e1002192 (2011).
- Kosinski, C., et al. Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors. Proc Natl Acad Sci U S A. 104, 15418-15423 (2007).
- Tamura, S., et al. Pit pattern and three-dimensional configuration of isolated crypts from the patients with colorectal neoplasm. J Gastroenterol. 37, 798-806 (2002).
- Geem, D., Medina-Contreras, O., Kim, W., Huang, C. S., Denning, T. L. Isolation and characterization of dendritic cells and macrophages from the mouse intestine. Journal of visualized experiments : JoVE. , e4040 (2012).
- Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
- Neumann, P. A., et al. Gut commensal bacteria and regional Wnt gene expression in the proximal versus distal colon. Am J Pathol. 184, 592-599 (2014).
- Capaldo, C. T., et al. Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins. Mol Biol Cell. 25, 2710-2719 (2014).
- Wells, J. M., Spence, J. R. How to make an intestine. Development. 141, 752-760 (2014).
