इस प्रोटोकॉल दर्शाता है कि कैसे ड्रोसोफिला आंख / antennal imaginal डिस्क (EAD) में fluorescently चिह्नित, आनुवंशिक रूप से परिभाषित प्रतिरूप ट्यूमर उत्पन्न करने के लिए। यह बताता है कि तीसरे instar लार्वा और कैसे कल्पना और जीन अभिव्यक्ति में परिवर्तन और ट्यूमर invasiveness यों तो उन्हें प्रक्रिया से EAD और मस्तिष्क काटना करने के लिए कैसे।
Drosophila melanogaster has emerged as a powerful experimental system for functional and mechanistic studies of tumor development and progression in the context of a whole organism. Sophisticated techniques to generate genetic mosaics facilitate induction of visually marked, genetically defined clones surrounded by normal tissue. The clones can be analyzed through diverse molecular, cellular and omics approaches. This study describes how to generate fluorescently labeled clonal tumors of varying malignancy in the eye/antennal imaginal discs (EAD) of Drosophila larvae using the Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. It describes procedures how to recover the mosaic EAD and brain from the larvae and how to process them for simultaneous imaging of fluorescent transgenic reporters and antibody staining. To facilitate molecular characterization of the mosaic tissue, we describe a protocol for isolation of total RNA from the EAD. The dissection procedure is suitable to recover EAD and brains from any larval stage. The fixation and staining protocol for imaginal discs works with a number of transgenic reporters and antibodies that recognize Drosophila proteins. The protocol for RNA isolation can be applied to various larval organs, whole larvae, and adult flies. Total RNA can be used for profiling of gene expression changes using candidate or genome-wide approaches. Finally, we detail a method for quantifying invasiveness of the clonal tumors. Although this method has limited use, its underlying concept is broadly applicable to other quantitative studies where cognitive bias must be avoided.
कैंसर रोग का सबसे आनुवंशिक रूप से विषम समूह, जिसका घटनाओं और मृत्यु दर नाटकीय रूप से बढ़ रही है, विशेष रूप से बुजुर्गों के बीच दुनिया भर में से एक का प्रतिनिधित्व करता है। कैंसर एक ट्यूमर की शुरुआत सेल कि निहित ट्यूमर शमन तंत्र पलायन और नियंत्रण से बाहर बिताते से clonally निकलती है। आनुवंशिक घावों कि सहयोगात्मक विकास, प्रसार और गतिशीलता को बढ़ावा देने मौत और भेदभाव बाधा जबकि क्रमिक संचय एक अत्यंत घातक मेटास्टेटिक और घातक ट्यूमर में प्रारंभिक सौम्य अतिवृद्धि बदल देती है। यह स्पष्ट हो गया है कि आनुवंशिक परिवर्तन के अलावा, ट्यूमर प्रगति आसपास के स्ट्रोमा और इसके microenvironment में ट्यूमर और अनेक प्रकार की कोशिकाओं (जैसे, fibroblasts, प्रतिरक्षा और endothelial कोशिकाओं) के बीच crosstalk में परिवर्तन की आवश्यकता है। ट्यूमर स्ट्रोमा बातचीत सहित घातक परिवर्तन अंतर्निहित आणविक सिद्धांतों को समझने preven के विकास के लिए बहुत महत्व का हैtion और जल्दी स्क्रीनिंग रणनीतियों, साथ ही नए और प्रभावी उपचार कैंसर मेटास्टेसिस और दवा प्रतिरोध का मुकाबला करने के लिए।
फल मक्खी ड्रोसोफिला मेलानोगास्टर कैंसर रिसर्च 1-4 के लिए एक आकर्षक प्रणाली अपनी तेजी पीढ़ी समय के कारण बन गया है, मक्खियों और मनुष्य, सीमित आनुवंशिक अतिरेक और उन्नत आनुवंशिक उपकरण है कि लगभग किसी भी जीन की हेरफेर की सुविधा के धन के बीच नोड्स संकेत की उल्लेखनीय संरक्षण एक अस्थायी रूप से और स्थानिक प्रतिबंधित तरीके से। बदलती द्रोह की आनुवंशिक रूप से परिभाषित ट्यूमर reproducibly MARCM तकनीक 5 का उपयोग कर एक अन्यथा जंगली प्रकार के ऊतकों में progenitors के एक सबसेट में gain- और नुकसान के समारोह के म्यूटेशन को शुरू करने से ड्रोसोफिला में इंजीनियर जा सकता है। MARCM उपकरण को जोड़ती है FLP / FRT (FLP recombinase / FLP मान्यता लक्ष्य) FLP-बाहर 7 और Gal4 / यूएएस (अपस्ट्रीम एक्टिवेशन अनुक्रम) 8 लक्ष्य जीन के साथ mitotic पुनर्संयोजन 6 मध्यस्थताअभिव्यक्ति सिस्टम 9। किसी भी यूएएस आधारित transgene की इस विधि अभिव्यक्ति, ओंकोजीन या फ्लोरोसेंट प्रोटीन cDNAs या dsRNA प्रेरित जीन मुंह बंद करने के लिए उलटा डीएनए दोहराता सहित साथ कोशिकाओं के एक क्लोन है कि एक विशिष्ट आनुवंशिक ठिकाना और पुनर्संयोजन के कारण एक Gal4 repressor खो दिया है करने के लिए प्रतिबंधित कर दिया जाएगा (चित्रा 1 ए)। क्लोनल पैच हरी फ्लोरोसेंट (GFP) या लाल फ्लोरोसेंट प्रोटीन के साथ चिह्नित (जैसे, आरएफपी, DsRed, mCherry) आसानी से विकास, पृथक और विश्लेषण के दौरान पता लगाया जा सकता है। महत्वपूर्ण बात है, उनके व्यवहार सीधे सटे जंगली प्रकार के ऊतकों की तुलना में हो सकता है। इस प्रकार, सवाल सेल आनुवंशिक घावों की स्वायत्त और गैर-स्वायत्त प्रभाव आसानी से अध्ययन किया जा सकता करने के लिए प्रासंगिक। स्तनधारियों के लिए भी इसी तरह, केवल क्लोन जिसमें कई ऑन्कोजेनिक घावों संयुक्त ड्रोसोफिला में घातक हो जाते हैं और स्तनधारी कैंसर के प्रमुख पहचान पुनरावृत्ति कर रहे हैं। वे overproliferate, apoptosis से बचने, सूजन पैदा, अमर और Inva हो जाते हैंनिर्णायक, अंततः मेजबान 10-17 मौत हो गई।
यहाँ, हम एक प्रोटोकॉल MARCM तकनीक का उपयोग ड्रोसोफिला लार्वा की आंख / antennal और मस्तिष्क के ऊतकों में आनुवंशिक रूप से परिभाषित प्रतिरूप ट्यूमर उत्पन्न करने का वर्णन है। विधि एक MARCM परीक्षक शेयर जो अंधा बढ़ाने (eyFLP) 18,19 के नियंत्रण में खमीर FLP recombinase व्यक्त करता है पर निर्भर करता है। इस तरह, GFP लेबल क्लोन EAD की peripodial और स्तंभ उपकला और भ्रूण और लार्वा चरणों (चित्रा 1 ए, बी और संदर्भ 20) के दौरान मस्तिष्क के neuroepithelium दोनों में उत्पन्न कर रहे हैं। जबकि neuroepithelium neuroblasts कि विभेदित ऑप्टिक पालि न्यूरॉन्स उत्पादन को जन्म देता है के रूप में EAD वयस्क आंख, एंटीना और सिर कैप्सूल में विकसित क्लोन आसानी से वयस्कता तक पीछा किया जा सकता।
पच्चीकारी ऊतक, हम डी के व्यापक, आणविक कार्यात्मक और प्ररूपी लक्षण वर्णन की सुविधा के लिएEAD और तीसरे instar लार्वा से मस्तिष्क के विच्छेदन के लिए एक प्रोटोकॉल मुंशी और रूपरेखा कैसे तीन विभिन्न अनुप्रयोगों के लिए उन्हें प्रक्रिया: (i) ट्रांसजेनिक फ्लोरोसेंट संवाददाताओं और immunostaining का पता लगाने, (ii) ट्यूमर invasiveness और (iii) के विश्लेषण की मात्रा का ठहराव जीन अभिव्यक्ति एक मात्रात्मक वास्तविक समय पीसीआर (QRT- पीसीआर) या एक उच्च throughput अनुक्रमण mRNA (mRNA-सेक) (चित्रा 1 सी) का उपयोग बदल जाता है।
immunostaining प्रोटोकॉल एक विशिष्ट एंटीबॉडी के साथ ब्याज की किसी भी प्रोटीन कल्पना करने के लिए इस्तेमाल किया जा सकता है। ट्रांसजेनिक फ्लोरोसेंट ट्रांसक्रिप्शनल पत्रकारों से एक विशेष संकेतन मार्ग की गतिविधि पर सुविधाजनक और सटीक spatiotemporal जानकारी प्रदान करते हैं। सेल-वंश विशिष्ट पत्रकारों, दूसरे हाथ पर, पच्चीकारी ऊतक के भीतर और अलग जीनोटाइप के ट्यूमर सेल आबादी के बीच में गुणात्मक और मात्रात्मक परिवर्तन को प्रतिबिंबित। आक्रामक व्यवहार की मात्रा जीनोटाइप के बीच ट्यूमर द्रोह की तुलना की सुविधाएस। अंत में, प्रोटोकॉल आरएनए अलगाव के लिए पच्चीकारी EAD का संग्रह और प्रसंस्करण का वर्णन इस तरह रिवर्स QRT- पीसीआर और जीनोम चौड़ा mRNA-सेक, क्रमशः के द्वारा पीछा प्रतिलेखन के रूप में दोनों छोटे और बड़े पैमाने पर बहाव के अनुप्रयोगों के लिए उपयुक्त है। इन assays से प्राप्त गुणात्मक और मात्रात्मक डेटा प्रतिरूप ट्यूमर के सामाजिक व्यवहार में उपन्यास अंतर्दृष्टि प्रदान करते हैं। इसके अलावा, वे अलग-अलग जीन, आनुवंशिक नेटवर्क और विभिन्न चरणों में ट्यूमर microenvironment और tumorigenesis के पहलुओं की भूमिका पर कार्यात्मक अध्ययन के लिए एक ठोस नींव का उत्पादन।
तकनीक उत्पन्न करने के लिए ड्रोसोफिला में आनुवंशिक मोज़ाइक विश्लेषण और जीन समारोह 33 से छेड़छाड़ के लिए सबसे अधिक परिष्कृत उपकरण शामिल हैं। EyFLP-MARCM प्रणाली शक्तिशाली और मजबूत सिद्ध के रूप में यह ए?…
The authors have nothing to disclose.
We thank the Bloomington Stock Center (Bloomington, USA), Dirk Bohmann, Katja Brückner and Istvan Ando for fly stocks, and antibodies. We thank Marek Jindra and Colin Donohoe for comments on the manuscript. This work was supported by the Sofja Kovalevskaja Award to M.U. from the Alexander von Humboldt Foundation and DFG project UH243/1-1 to M.U. from the German Research Foundation.
Agar | Gewürzmühle Brecht, Eggenstein, Germany | 00262-0500 | Fly food recipe: Prepare 20 L fly food with 160 g agar, 360 g yeast, 200 g soy flour, 1.6 kg yellow cornmeal, 1.2 L malt extract, 300 ml light corn syrup, 130 ml propionic acid and 200 ml 15% nipagin. Fly food should be cooked for 1 hour at 85°C. |
Corn syrup | Grafschafter Krautfabrik Josef Schmitz KG, Meckenheim, Germany | 01939 | |
Propionic acid | Carl Roth GmbH, Karlsruhe, Germany | 6026.1 | |
Cornmeal | ReformKontor GmbH, Zarrentin, Germany | 4010155063948 | |
Malt extract | CSM Deutschland GmbH, Bremen, Germany | 728985 | |
Soy flour | Stockmeier Food GmbH, Herford, Germany | 1000246441010 | |
Yeast | Werner Ramspeck GmbH, Schwabach, Germany | 210099K | |
Methyl-4-benzoate/ Nipagin | Sigma-Aldrich, Deisenhofen, Germany | H5501 | Prepare a 15% stock solution with 70% EtOH |
Drosophila fly food vials | Kisker Biotech, Steinfurt, Germany | 789008 | |
Vial plugs | K-TK e.K., Retzstadt, Germany | 1002 | |
Drosophila fly food bottles | Greiner Bio-One, Frickenhausen, Germany | 960177 | |
Bottle plugs | K-TK e.K., Retzstadt, Germany | 1002 S | |
Poly(vinyl alcohol) 4-88/[-CH2CHOH-]n | Sigma-Aldrich, Deisenhofen, Germany | 81381 | Mounting medium recipe: Dissolve 6 g Poly(vinyl alcohol) 4-88 in 39 ml Millipore H2O, 6 ml 1 M Tris (pH 8.5) and 12.5 ml glycerol. Stir overnight at 50°C and centrifuge 20 min at 5000 rpm. Add DABCO to the supernatant to get a final concentration of 2.5%. Store aliquots at -20°C. |
1,4-Diazabicyclo[2.2.2]octane/ DABCO | Sigma-Aldrich, Deisenhofen, Germany | D2522 | |
Triton X-100 | Sigma-Aldrich, Deisenhofen, Germany | 9002-93-1 | |
Phosphate-buffered saline/ PBS | 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 and 1.8 mM KH2PO4, pH 7.4 in Millipore H2O | ||
PBST | 0.1% Triton X-100 in PBS | ||
Paraformaldehyde/ PFA | Sigma-Aldrich, Deisenhofen, Germany | 158127 | 4% PFA fixative recipe: Dissolve 4 g PFA in 80 ml Millipore H2O on a magnetic stirrer plate heated to 55 °C. Add 1M NaOH dropwise until all PFA particles are dissolved. Add 10 ml 10X PBS and adjust the pH to 7.4 with 1M HCl. Mix in 100 µl Triton X-100 and fill up with Millipore H2O to 100 ml. Store aliquots at -20°C. Avoid repeated thawing. (CAUTION: PFA is highly toxic. Prepare the PFA fixative in a fume hood. Wear a self-contained breathing apparatus, gloves and clothing. Avoid contact with skin, eyes or mucous membranes) |
Bovine Serum Albumin/ BSA | Sigma-Aldrich, Deisenhofen, Germany | A3059 | Blocking solution recipe: Dissolve 0.3% BSA in PBST |
4’,6-Diamidino-2-phenylindol Dihydrochlorid/ DAPI | Carl Roth GmbH, Karlsruhe, Germany | 6335 | DAPI staining solution: Prepare a stock solution of 5 mg/ml in Millipore H2O and store aliquots at 4°C. Used in dilution 1:1000 in PBST. |
Alexa Flour 546 Phalloidin | Invitrogen, Karlsruhe, Germany | A22283 | Used in dilution 1:500 in PBST. |
Mouse anti-H2 antibody | Kurucz et al., 2003 | Used in dilution 1:500 in blocking solution | |
Cy5 AffiniPure Donkey Anti-Mouse IgG (H+L) | Jackson ImmunoResearch, Suffolk, UK | 715-175-151 | Used in dilution 1:500 in blocking solution |
Dumont #5 forceps | Fine Science Tools, Heidelberg, Germany | 11295-10 | |
Glass embryo dish (30 mm) | Thermo Scientific, Schwerte, Germany | E90 | |
Tungsten needles | Fine Science Tools, Heidelberg, Germany | 10130-20 | |
Nickel Plated Pin Holder | Fine Science Tools, Heidelberg, Germany | 26018-17 | |
Microscope slides | VWR, Darmstadt, Germany | 631-1553 | |
Coverslips 22 x 22 mm (#1 Menzel-Gläser) | VWR, Darmstadt, Germany | 631-1336 | |
Coverslips 24 x 50 mm (0.13-0.16 mm) | Thermo Scientific, Schwerte, Germany | 1076371 | |
Kimtech Science Precision Wipes | Thermo Scientific, Schwerte, Germany | 06-677-70 | |
Dissecting stereomicroscope | Olympus, Hamburg, Germany | SZX7 (DF PLAPO 1X-4 Japan) | |
Fluorescent stereomicroscope | Olympus, Hamburg, Germany | SZX16 (SDF PLAPO 0.8X Japan) with DP72 CCD camera | Equipped with the narrow blue bandpass filter set for excitation of GFP other blue excitable fluorochromes (excitation filter BP460-480 nm, barrier filter BA495-540 nm) and narrow green excitation and longpass barrier filter for RFP and other green excitable fluorochromes (excitation filter BP530-550, barrier filter BA575IF). Software: Olympus cellSens Standard 1.11. |
Confocal microscope | Olympus, Hamburg, Germany | FV1000 | Equipped with inverted IX81 microscope. Objectives: 20× UPlan S-Apo (NA 0.85), 40× UPlanFL (NA 1.30) and 60× UPlanApo (NA 1.35). Lasers: UV laser Diode LD405 (50mW), Argon laser, multi-line 457/(476)/ 488/515 (40mW), Yellow/Green laser diode LD560 (15mW) and Red Laser diode 635 (20mW). Software: Fluoview 2.1c Software |
Drosophila cooled incubator | Ewald Innovationstechnik GmbH, Bad Nenndorf, Germany | Sanyo MIR553 | |
Squirt bottle | VWR, Darmstadt, Germany | 215-8105 | |
BD Clay Adams Nutator Mixer | VWR, Darmstadt, Germany | 15172-203 | |
ELMI Digital Rocking Shaker | VWR, Darmstadt, Germany | DRS-12 | |
5 PRIME Isol-RNA Lysis Reagent | VWR, Darmstadt, Germany | 2302700 | The protocol is compatible with other TRIzol-based reagents e.g. TRIreagent from Sigma (Cat. Nr.T9424), TRIzol reagent from Thermofisher (Cat. Nr. 15596). |
Diethyl pyrocarbonate/ DEPC | Sigma-Aldrich, Deisenhofen, Germany | D5758 | Dilute DEPC 1:1000 in Millipore H2O, stir overnight and autoclave. |
UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1) | ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany | 15593-031 | |
Chloroform | Merck, Darmstadt, Germany | 102445 | |
TURBO DNase (2 U/µl) | Thermo Scientific, Schwerte, Germany | AM2238 | |
Invitrogen UltraPure Glycogen | ThermoFischer Scientific, Invitrogen, Karlsruhe, Germany | 10-814-010 | |
Sodium acetate trihydrate | VWR, Darmstadt, Germany | 27652.232 | Prepare a 3M Sodium acetate solution with DEPC-H2O and adjust the pH to 5.2 |
2-Propanol | Merck, Darmstadt, Germany | 109634 | |
Ethanol | Merck, Darmstadt, Germany | 100983 | Prepare a 75% EtOH dilution with DEPC-H2O. |
UV/Vis-Spectrophotometre NanoDrop ND-8000 | Thermo Scientific, Schwerte, Germany | ND-8000 | |
Eppendorf Microcentrifuge (Refrigerated) | Thermo Scientific, Schwerte, Germany | 5417R | |
Experion RNA StdSens Analysis Kit | Bio-Rad Laboratories GmbH, München, Germany | 7007103 | |
Experion Automated Electrophoresis Station | Bio-Rad Laboratories GmbH, München, Germany | 7007010 | |
SuperScript III Reverse Transcriptase | Thermo Scientific, Schwerte, Germany | 18080044 | |
Oligo d(T) Primer | Integrated DNA Technologies, Leuven, Belgium | Prepare 100 µM stock solutions in DEPC-H20 and store at -20°C | |
dNTP Mixture | Takara Bio Europe/Clonetech, Saint-Germain-en-Laye, France | 4030 | Store aliquots of 25 µl at -20°C |
CFX96 Touch Real-Time PCR Detection System | Bio-Rad Laboratories GmbH, München, Germany | 1855195 | |
iQ SYBR Green Supermix | Bio-Rad Laboratories GmbH, München, Germany | 170-8882 | |
Hard-Shell PCR Plates 96-well, thin wall | Bio-Rad Laboratories GmbH, München, Germany | HSP9601 | |
Microseal 'B' Film | Bio-Rad Laboratories GmbH, München, Germany | MSB1001 | |
rp49 Forward primer | Integrated DNA Technologies, Leuven, Belgium | 5' TCCTACCAGCTTCAAGATGAC 3' | |
rp49 Reverse primer | Integrated DNA Technologies, Leuven, Belgium | 5' CACGTTGTGCACCAGGAACT 3' | |
mmp1 Forward primer | Integrated DNA Technologies, Leuven, Belgium | 5' AGGGCGACAAGTACTACAAGCTGA 3' | |
mmp1 Reverse primer | Integrated DNA Technologies, Leuven, Belgium | 5' ACGTCTTGCCGTTCTTGTAGGTGA 3' |