단일 벽 탄소 나노튜브 (SWCNT)에 의해 생체 내에서 여러 Myeloma 세포 성장 억압-MALAT1 센스 Oligos 전달
Summary
이 원고는 단일 벽 탄소 나노튜브 (SWCNT)의 합성에 설명 합니다-는 SWCNT의 안정적인 납품과의 강력한 치료 효과 보여 주는 MALAT1 센스 gapmer DNA oligonucleotide (SWCNT-안티-MALAT1) 활용 안티-MALAT1 생체 외에서 그리고 vivo. 합성, 수정, 활용, 사용 하는 방법 그리고 주입 SWCNT-안티-MALAT1의 설명.
Abstract
단일 벽 탄소 나노튜브 (SWCNT)는 새로운 유형의 나노, 세포, 단백질, oligonucleotides, 합성 작은 분자 약물 등으로 약의 여러 종류를 제공 하는 데 사용 되었습니다. SWCNT 사용자 정의 크기, 큰 표면 영역 있고 유연 하 게 표면;에 다른 수정 마약으로 바인딩할 수 있습니다. 따라서, 셀으로 마약을 수송 하는 이상적인 시스템 이다. 긴 noncoding RNAs (lncRNAs)는 200 이상 noncoding RNA의 클러스터 nt는 단백질에 번역 될 수 없습니다 하지만 생물 학적 및 병 태 생리 과정에 중요 한 역할. 전이 관련 된 폐 선 암 사본 1 (MALAT1)은 매우 보존된 lncRNA 이다. 그것은 상부 MALAT1 여러 발성 (MM)를 포함 한 다양 한 암에서의 빈약한 예 지에 관련 된 시연 했다. 우리 MALAT1 mm; DNA 수리 및 세포 죽음 통제 밝혀졌다 따라서, MALAT1 m M에 대 한 치료 대상으로 간주 될 수 있습니다. 그러나, 센스 oligo의 억제/최저 MALAT1 vivo에서 효율적인 배달 여전히 문제입니다. 이 연구에서 우리 못 2000 SWCNT 수정 그것에 안티 MALAT1 올리고 켤레, 테스트 생체 외에서 화합물의 배달, 전파 m M 마우스 모델, 정 맥 주입 하 고 나타내는 m M 진행의 중요 한 금지를 관찰 그 SWCNT 안티 MALAT1 gapmer DNA에 대 한 이상적인 배달 셔틀 이다.
Introduction
SWCNT 소설을 접한 제공할 수 있는 다양 한 유형의 약물, 단백질, 작은 분자, 핵 산 등 안정적이 고 효율적으로 이상적인 tolerability와 시험관1 에 vivo에서2최소 독성입니다. 기능성된 SWCNT 좋은 생체 적합성 및 물 가용성, 작은 분자에 대 한 셔틀으로 사용 될 수 있으며 세포 막3,,45에 침투 하는 그들을 가져올 수 있다.
lncRNAs는 RNA의 클러스터 (> 200 nt) 게놈에서 mRNA를 복사할 수는 있지만 단백질에 번역 될 수 없습니다. LncRNAs 유전자 식6 의 규칙에 참여 하 고 개시와 대부분의 유형의 암, m M7,8,9등의 진행에 관련 된 증거를 증가 보이고 있다. MALAT1 핵 농축 noncoding 사본을 2 (NEAT2)은 매우 보존된 lncRNA10. MALAT1 전이성 비 작은 세포 폐 암 (NSCLC)11, 처음 인식 하지만 수많은 종양5,,1213;에 overexpressed 되었습니다. 그것은 가장 높은 표현된 lncRNAs 중 하나 이며 m M8,14에서 가난한 예 후와 상관 된다. MALAT1 식 수준 치명적인 코스 extramedullary m M 환자 m M15로 진단만 그에 비해 크게 높은 수준 이다.
이전 연구에서 우리는 안티-MALAT1 oligos 튼튼하게 이어질 DNA 손상 및 m M16 에서 apoptosis gapmer DNA 센스 oligonucleotides MALAT1 타겟팅을 사용 하 여 확인 했습니다 (안티-MALAT1) MM 셀에서. Gapmer DNA 센스 DNA의 구성 이며 2′-오메-RNAs, RNase H 한 번 바운드 활동17여 MALAT1 분열을 프롬프트 수 있는 연결. 센스 oligos의 생체 조건 납품 효율성은 아직도 그것의 임상 사용을 제한합니다.
배달 테스트 안티 MALAT1 gapmer oligos, DNA DSPE-PEG2000-아민에 활용 된 안티 MALAT1 gapmer에 대 한 SWCNT의 효과 기능성 SWCNT. SWCNT 안티 MALAT1 다음 주입 정 맥 MM 전파 마우스 모델; 눈에 띄는 억제 4 치료 후 관찰 됩니다.
Protocol
모든 실험 동물 관련 된 사전 (기관 동물 관리 및 사용 위원회) 클리블랜드 클리닉 IACUC에 의해 승인 되었다. 1입니다. 기능성된 SWCNTs의 합성 SWCNTs, DSPE-PEG2000-아민의 5 mg 및 유리 섬광 유리병 (20 mL) 소독된 nuclease 무료 물 5 mL의 혼합 1 밀리 그램. 흔들어 모든 시 약을 완전히 분해 하는 게. 실 온에서 1 h 40 W의 전력 레벨에서 물 목욕 sonicator에 유리병을 sonicate (RT, 20 ?…
Representative Results
안티 MALAT1 gapmer m M에서 DNA의 억제 효과 보여, 우리 MALAT1의 식을 무 너 뜨 하 고 H929 및 MM.1S 세포에 그것을 사용. 48 시간 후, 셀 눕 힘 효율성의 분석을 위해 수집 하 고 안티 MALAT1 gapmer 또는 컨트롤 DNA transfected 세포에 있는 apoptosis 상태. qRT-PCR 결과 안티 MALAT1 gapmer DNA 뜨 MALAT1 식 H929 및 MM.1S 세포에 효율적으로 나타났다 (그림 2A). Apoptosis의 상…
Discussion
LncRNAs m M7,,89;를 포함 하 여 암에 수많은 생리 및 병 태 생리 절차의 규칙에 참여를 보이고 있다는 증거 그들은 센스 oligonucleotides20,,2122에 의해 실현 될 수 있는 암 치료에 대 한 타겟이 될 가능성이 있다. 미국 식품 및 의약품 안전 청 (FDA)는 세포 망막<sup class…
Divulgazioni
The authors have nothing to disclose.
Acknowledgements
저자 러너 연구소 proteomic, 게놈, 및 그들의 지원에 대 한 이미징 코어를 감사 하 고 지원 합니다. 자금:이 작품 NIH/NCI 부여 R00 CA172292 (J.J.Z.) (J.J.Z.)을 창업 자금 및 임상 및 변환 과학 공동 (CTSC) 케이스 서쪽 예비 대학 코어 사용률 파일럿 부여 (J.J.Z.)의 의해 재정적으로 지원 되었다. 이 작품 활용 건강 SIG의 국가 학회 교부 금 1S10OD019972-01 자금 구입 했던 Leica SP8 confocal 현미경.
Materials
| SWCNTs | Millipore-Sigma | 704113 | |
| DSPE-PEG2000-Amine | Avanti Polar Lipids | 880128 | |
| bath sonicator | VWR | 97043-992 | |
| 4 mL centrifugal filter | Millipore-Sigma | Z740208-8EA | |
| UV/VIS spectrometer | Thermo Fisher Scientific | accuSkan GO UV/Vis Microplate Spectrophotometer | extinction coefficient of 0.0465 L/mg/cm at 808 nm |
| Sulfo-LC-SPDP | ProteoChem | c1118 | |
| DTT solution | Millipore-Sigma | 43815 | |
| NAP-5 column | GE Healthcare | 17-0853-01 | |
| in vivo imaging system | PerkinElmer | ||
| NOD.CB17-Prkdcscid/J mice | Charles River lab | 250 | |
| Flow cytometer | Becton Dickinso | ||
| Lipofectamine | Invitrogen | 11668019 | Lipofectamine2000 |
| Fetal bovine serum (FBS) | Invitrogen | 10437-028 | |
| RMPI-1640 medium | Invitrogen | 11875-093 | |
| MALAT1-QF: | synthesized by IDT Company | 5’- GTTCTGATCCCGCTGCTATT – 3’ | |
| MALAT1-QR: | synthesized by IDT Company | 5’- TCCTCAACACTCAGCCTTTATC – 3’ | |
| GAPDH-QF: | synthesized by IDT Company | 5’- CAAGAGCACAAGAGGAAGAGAG – 3’ | |
| GAPDH-QR: | synthesized by IDT Company | 5’- CTACATGGCAACTGTGAGGAG – 3’ | |
| Quantitative PCR using SYBR Green PCR master mix | Thermo Fisher Scientific | A25780 | |
| RevertAid first-stand cDNA synthesis kit | Thermo Fisher Scientific | K1621 | |
| anti-MALAT1 | synthesized by IDT Company | 5’-mC*mG*mA*mA*mA*C*A*T*T *G*G*C*A*C*A*mC*mA*mG*mC*mA-3’ |
|
| Cell Viability Assay Kit | Promega Corporation | G7570 | CellTiter-GloLuminescent Cell Viability Assay Kit |
| accuSkan GO UV/Vis Microplate Spectrophotometer | Thermo Fisher Scientific | ||
| centrifugal filter | Millipore-Sigma | UFC910008 | |
| SPSS software | IBM | version 24.0 | |
| D-Luciferin | Millipore-Sigma | L9504 |
Riferimenti
- Jiang, X., et al. RNase non-sensitive and endocytosis independent siRNA delivery system: delivery of siRNA into tumor cells and high efficiency induction of apoptosis. Nanoscale. 5 (16), 7256-7264 (2013).
- Murakami, T., et al. Water-dispersed single-wall carbon nanohorns as drug carriers for local cancer chemotherapy. Nanomedicine (Lond). 3 (4), 453-463 (2008).
- Kam, N. W., Dai, H. Carbon nanotubes as intracellular protein transporters: generality and biological functionality. Journal of the American Chemical Society. 127 (16), 6021-6026 (2005).
- Kam, N. W., Liu, Z., Dai, H. Functionalization of carbon nanotubes via. cleavable disulfide bonds for efficient intracellular delivery of siRNA and potent gene silencing. Journal of the American Chemical Society. 127 (36), 12492-12493 (2005).
- Kam, N. W., Liu, Z., Dai, H. Carbon nanotubes as intracellular transporters for proteins and DNA: an investigation of the uptake mechanism and pathway. Angewandte Chemie International Edition in English. 45 (4), 577-581 (2006).
- Ntziachristos, P., Abdel-Wahab, O., Aifantis, I. Emerging concepts of epigenetic dysregulation in hematological malignancies. Nature Immunology. 17 (9), 1016-1024 (2016).
- Evans, J. R., Feng, F. Y., Chinnaiyan, A. M. The bright side of dark matter: lncRNAs in cancer. Journal of Clinical Investigation. 126 (8), 2775-2782 (2016).
- Ronchetti, D., et al. Distinct lncRNA transcriptional fingerprints characterize progressive stages of multiple myeloma. Oncotarget. 7 (12), 14814-14830 (2016).
- Wong, K. Y., et al. Epigenetic silencing of a long non-coding RNA KIAA0495 in multiple myeloma. Molecular Cancer. 14, 175 (2015).
- Schmidt, L. H., et al. The long noncoding MALAT-1 RNA indicates a poor prognosis in non-small cell lung cancer and induces migration and tumor growth. Journal of Thoracic Oncology. 6 (12), 1984-1992 (2011).
- Ji, P., et al. MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer. Oncogene. 22 (39), 8031-8041 (2003).
- Luo, J. H., et al. Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas. Hepatology. 44 (4), 1012-1024 (2006).
- Guffanti, A., et al. A transcriptional sketch of a primary human breast cancer by 454 deep sequencing. BMC Genomics. 10, 163 (2009).
- Cho, S. F., et al. MALAT1 long non-coding RNA is overexpressed in multiple myeloma and may serve as a marker to predict disease progression. BMC Cancer. 14, 809 (2014).
- Handa, H., et al. Long non-coding RNA MALAT1 is an inducible stress response gene associated with extramedullary spread and poor prognosis of multiple myeloma. British Journal of Haematology. 179 (3), 449-460 (2017).
- Hu, Y., et al. Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma. Leukemia. , (2018).
- Lennox, K. A., Behlke, M. A. Cellular localization of long non-coding RNAs affects silencing by RNAi more than by antisense oligonucleotides. Nucleic Acids Research. 44 (2), 863-877 (2016).
- Kam, N. W., O’Connell, M., Wisdom, J. A., Dai, H. Carbon nanotubes as multifunctional biological transporters and near-infrared agents for selective cancer cell destruction. Proceedings of the National Academy of Sciences of the United States of America. 102 (33), 11600-11605 (2005).
- Zeineldin, R., Al-Haik, M., Hudson, L. G. Role of polyethylene glycol integrity in specific receptor targeting of carbon nanotubes to cancer cells. Nano Letters. 9 (2), 751-757 (2009).
- Amodio, N., D’Aquila, P., Passarino, G., Tassone, P., Bellizzi, D. Epigenetic modifications in multiple myeloma: recent advances on the role of DNA and histone methylation. Expert Opinion on Therapeutic Targets. 21 (1), 91-101 (2017).
- Ahmad, N., Haider, S., Jagannathan, S., Anaissie, E., Driscoll, J. J. MicroRNA theragnostics for the clinical management of multiple myeloma. Leukemia. 28 (4), 732-738 (2014).
- Amodio, N., et al. Drugging the lncRNA MALAT1 via. LNA gapmeR ASO inhibits gene expression of proteasome subunits and triggers anti-multiple myeloma activity. Leukemia. , (2018).
- Highleyman, L. FDA approves fomivirsen, famciclovir, and Thalidomide. Food and Drug Administration. BETA. 5, (1998).
- Smith, R. J., Hiatt, W. R. Two new drugs for homozygous familial hypercholesterolemia: managing benefits and risks in a rare disorder. JAMA Internal Medicine. 173 (16), 1491-1492 (2013).
- Aartsma-Rus, A. FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides. Nucleic Acid Therapeutics. 27 (2), 67-69 (2017).
- Nelson, S. F., Miceli, M. C. FDA Approval of Eteplirsen for Muscular Dystrophy. The Journal of the American Medical Association. 317 (14), 1480 (2017).
- Liu, Z., Sun, X., Nakayama-Ratchford, N., Dai, H. Supramolecular chemistry on water-soluble carbon nanotubes for drug loading and delivery. American Chemical Society Nano. 1 (1), 50-56 (2007).
- Ali-Boucetta, H., et al. Multiwalled carbon nanotube-doxorubicin supramolecular complexes for cancer therapeutics. Chemical communications (Cambridge). (4), 459-461 (2008).
- Bianco, A., Kostarelos, K., Partidos, C. D., Prato, M. Biomedical applications of functionalised carbon nanotubes. Chemical communications. (5), 571-577 (2005).
- Hadidi, N., Kobarfard, F., Nafissi-Varcheh, N., Aboofazeli, R. Optimization of single-walled carbon nanotube solubility by noncovalent PEGylation using experimental design methods. International Journal of Nanomedicine. 6, 737-746 (2011).
- Padilla-Parra, S., et al. Quantitative imaging of endosome acidification and single retrovirus fusion with distinct pools of early endosomes. Proceedings of the National Academy of Sciences of the United States of America. 109 (43), 17627-17632 (2012).
- Wu, H., Zhu, L., Torchilin, V. P. pH-sensitive poly(histidine)-PEG/DSPE-PEG co-polymer micelles for cytosolic drug delivery. Biomaterials. 34 (4), 1213-1222 (2013).
- Oishi, M., Nagatsugi, F., Sasaki, S., Nagasaki, Y., Kataoka, K. Smart polyion complex micelles for targeted intracellular delivery of PEGylated antisense oligonucleotides containing acid-labile linkages. Chembiochem. 6 (4), 718-725 (2005).
- Dong, H., Ding, L., Yan, F., Ji, H., Ju, H. The use of polyethylenimine-grafted graphene nanoribbon for cellular delivery of locked nucleic acid modified molecular beacon for recognition of microRNA. Biomaterials. 32 (15), 3875-3882 (2011).
- Arunachalam, B., Phan, U. T., Geuze, H. J., Cresswell, P. Enzymatic reduction of disulfide bonds in lysosomes: characterization of a gamma-interferon-inducible lysosomal thiol reductase (GILT). Proceedings of the National Academy of Sciences of the United States of America. 97 (2), 745-750 (2000).
- Lelimousin, M., Sansom, M. S. Membrane perturbation by carbon nanotube insertion: pathways to internalization. Small. 9 (21), 3639-3646 (2013).
- Thomas, M., Enciso, M., Hilder, T. A. Insertion mechanism and stability of boron nitride nanotubes in lipid bilayers. J Phys Chem B. 119 (15), 4929-4936 (2015).
- Jin, H., Heller, D. A., Strano, M. S. Single-particle tracking of endocytosis and exocytosis of single-walled carbon nanotubes in NIH-3T3 cells. Nano Letters. 8 (6), 1577-1585 (2008).
- Jin, H., Heller, D. A., Sharma, R., Strano, M. S. Size-dependent cellular uptake and expulsion of single-walled carbon nanotubes: single particle tracking and a generic uptake model for nanoparticles. American Chemical Society Nano. 3 (1), 149-158 (2009).
- Ruggiero, A., et al. Paradoxical glomerular filtration of carbon nanotubes. Proceedings of the National Academy of Sciences of the United States of America. 107 (27), 12369-12374 (2010).
Citazione di questo articolo
Lin, J., Hu, Y., Zhao, J. Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube (SWCNT)-delivered MALAT1 Antisense Oligos. J. Vis. Exp. (142), e58598, doi:10.3791/58598 (2018).