Undertrykkelse av myelom cellevekst i Vivo av enkelt-vegg Carbon nanorør (SWCNT)-levert MALAT1 Antisense Oligos
Summary
Dette manuskriptet beskriver syntesen av en enkelt-vegg carbon nanorør (SWCNT)-konjugert MALAT1 antisense gapmer DNA oligonucleotide (SWCNT-anti-MALAT1), som viser pålitelig levering av SWCNT og den potente terapeutiske effekten av anti-MALAT1 i vitro og in vivo. Metoder brukt for syntese, modifisering, bøyning og injeksjon av SWCNT-anti-MALAT1 er beskrevet.
Abstract
Enkelt-vegg carbon nanorør (SWCNT) er en ny type hydrogenion, som er brukt til å levere flere typer narkotika inn celler, for eksempel proteiner, oligonucleotides og syntetiske små molekyl narkotika. SWCNT har passelig dimensjoner, et stort overfladisk område, og kan fleksibelt binde med narkotika gjennom forskjellige modifikasjoner på overflaten; Derfor er det et ideelt system å transportere narkotika i celler. Lang noncoding RNAs (lncRNAs) er en klynge av noncoding lenger enn 200 nt, som ikke kan oversettes til protein, men spiller en viktig rolle i biologiske og patofysiologiske. Metastasering-assosiert lunge adenocarcinoma transkripsjon 1 (MALAT1) er en høyt konservert lncRNA. Det ble demonstrert at høyere MALAT1 nivåer er knyttet til dårlig prognosen for ulike kreftformer, herunder myelom (MM). Vi har avdekket at MALAT1 regulerer DNA reparasjon og celle død i MM; MALAT1 kan dermed betraktes som et terapeutisk mål for MM. Effektiv levering av den antisense oligo å hemme/knockdown MALAT1 i vivo er imidlertid fortsatt et problem. I denne studien vi endre SWCNT med PEG-2000 og bøy en anti-MALAT1 oligo den, teste levering av denne sammensatte i vitro, injisere den intravenøst i spres MM musemodell og observere en betydelig hemming av MM progresjon, som angir det SWCNT er en ideell levering transporttjeneste for anti-MALAT1 gapmer DNA.
Introduction
SWCNT er en ny nanomaterial som kan levere ulike typer narkotika, som proteiner, små molekyler og atomer syren, stabilt og effektivt med ideelle toleranse og minimum toksisitet i vitro1 og i vivo2. En functionalized SWCNT har stor biocompatibility og vann løselighet, kan brukes som en transporttjeneste for mindre molekyler og kan bære dem å trenge celle membran3,4,5.
lncRNAs er en klynge av RNA (> 200 nt) som er transkribert fra genomet til mRNA men ikke kan oversettes til proteiner. Økende bevis har vist at lncRNAs delta i regulering av gene expression6 og er involvert i oppstart og progresjon av de fleste typer kreft, inkludert MM7,8,9. MALAT1 er en kjernefysisk-beriket noncoding transkripsjon 2 (NEAT2) og en høyt konservert lncRNA10. MALAT1 er først anerkjent i metastatisk ikke-småcellet lungekreft kreft (NSCLC)11, men har vært overexpressed i mange svulster5,12,13; Det er en av de mest uttrykte lncRNAs er korrelert med en dårlig prognose i MM8,14. Hvilket uttrykk MALAT1 er betydelig høyere i dødelig kurs extramedullary MM pasienter sammenlignet med de bare diagnostisert som MM15.
I en tidligere studie, har vi bekreftet at anti-MALAT1 oligos robust føre til DNA skade og apoptose i MM16 ved hjelp gapmer DNA antisense oligonucleotides rettet mot MALAT1 (anti-MALAT1) i MM celler. Gapmer DNA er sammensatt av antisense DNA og forbundet med 2-OMe-RNAs, som kunne be MALAT1 spalting av RNase H aktivitet når bundet17. I vivo levering effektiviteten av antisense oligos fortsatt begrenser klinisk bruk.
For å teste levering functionalized effekten av SWCNT for anti-MALAT1 gapmer oligos, anti-MALAT1 gapmer DNA er konjugert til DSPE-PEG2000-Amin SWCNT. SWCNT-anti-MALAT1 er deretter sprøytes intravenøst inn en MM spres musemodell; en slående hemming er observert etter fire behandlinger.
Protocol
Representative Results
Discussion
Bevis har vist at lncRNAs tar del i regulering av mange fysiologiske og patofysiologiske prosedyrer i kreft, inkludert MM7,8,9; de har potensial til å bli mål for kreftbehandling, noe som kan realiseres ved antisense oligonucleotides20,21,22. US Food and Drug Administration (FDA) har godkjent flere antisense oligonucleotide stoffer, i…
Divulgazioni
The authors have nothing to disclose.
Acknowledgements
Forfatterne takke Lerner Research Institute proteomic, genomisk, og tenkelig kjerner for deres hjelp og støtte. Finansiering: Dette arbeidet ble økonomisk støttet av NIH/NCI grant R00 CA172292 (til J.J.Z.) og oppstart midler (til J.J.Z.) og kliniske og translasjonsforskning Science samarbeid (CTSC) av Case Western Reserve University Core utnyttelse Pilot Grant (til J.J.Z.). Dette arbeidet utnyttet Leica SP8 AC confocal mikroskop som ble kjøpt med støtte fra nasjonale institutter for helse SIG grant 1S10OD019972-01.
Materials
| SWCNTs | Millipore-Sigma | 704113 | |
| DSPE-PEG2000-Amine | Avanti Polar Lipids | 880128 | |
| bath sonicator | VWR | 97043-992 | |
| 4 mL centrifugal filter | Millipore-Sigma | Z740208-8EA | |
| UV/VIS spectrometer | Thermo Fisher Scientific | accuSkan GO UV/Vis Microplate Spectrophotometer | extinction coefficient of 0.0465 L/mg/cm at 808 nm |
| Sulfo-LC-SPDP | ProteoChem | c1118 | |
| DTT solution | Millipore-Sigma | 43815 | |
| NAP-5 column | GE Healthcare | 17-0853-01 | |
| in vivo imaging system | PerkinElmer | ||
| NOD.CB17-Prkdcscid/J mice | Charles River lab | 250 | |
| Flow cytometer | Becton Dickinso | ||
| Lipofectamine | Invitrogen | 11668019 | Lipofectamine2000 |
| Fetal bovine serum (FBS) | Invitrogen | 10437-028 | |
| RMPI-1640 medium | Invitrogen | 11875-093 | |
| MALAT1-QF: | synthesized by IDT Company | 5’- GTTCTGATCCCGCTGCTATT – 3’ | |
| MALAT1-QR: | synthesized by IDT Company | 5’- TCCTCAACACTCAGCCTTTATC – 3’ | |
| GAPDH-QF: | synthesized by IDT Company | 5’- CAAGAGCACAAGAGGAAGAGAG – 3’ | |
| GAPDH-QR: | synthesized by IDT Company | 5’- CTACATGGCAACTGTGAGGAG – 3’ | |
| Quantitative PCR using SYBR Green PCR master mix | Thermo Fisher Scientific | A25780 | |
| RevertAid first-stand cDNA synthesis kit | Thermo Fisher Scientific | K1621 | |
| anti-MALAT1 | synthesized by IDT Company | 5’-mC*mG*mA*mA*mA*C*A*T*T *G*G*C*A*C*A*mC*mA*mG*mC*mA-3’ |
|
| Cell Viability Assay Kit | Promega Corporation | G7570 | CellTiter-GloLuminescent Cell Viability Assay Kit |
| accuSkan GO UV/Vis Microplate Spectrophotometer | Thermo Fisher Scientific | ||
| centrifugal filter | Millipore-Sigma | UFC910008 | |
| SPSS software | IBM | version 24.0 | |
| D-Luciferin | Millipore-Sigma | L9504 |
Riferimenti
- Jiang, X., et al. RNase non-sensitive and endocytosis independent siRNA delivery system: delivery of siRNA into tumor cells and high efficiency induction of apoptosis. Nanoscale. 5 (16), 7256-7264 (2013).
- Murakami, T., et al. Water-dispersed single-wall carbon nanohorns as drug carriers for local cancer chemotherapy. Nanomedicine (Lond). 3 (4), 453-463 (2008).
- Kam, N. W., Dai, H. Carbon nanotubes as intracellular protein transporters: generality and biological functionality. Journal of the American Chemical Society. 127 (16), 6021-6026 (2005).
- Kam, N. W., Liu, Z., Dai, H. Functionalization of carbon nanotubes via. cleavable disulfide bonds for efficient intracellular delivery of siRNA and potent gene silencing. Journal of the American Chemical Society. 127 (36), 12492-12493 (2005).
- Kam, N. W., Liu, Z., Dai, H. Carbon nanotubes as intracellular transporters for proteins and DNA: an investigation of the uptake mechanism and pathway. Angewandte Chemie International Edition in English. 45 (4), 577-581 (2006).
- Ntziachristos, P., Abdel-Wahab, O., Aifantis, I. Emerging concepts of epigenetic dysregulation in hematological malignancies. Nature Immunology. 17 (9), 1016-1024 (2016).
- Evans, J. R., Feng, F. Y., Chinnaiyan, A. M. The bright side of dark matter: lncRNAs in cancer. Journal of Clinical Investigation. 126 (8), 2775-2782 (2016).
- Ronchetti, D., et al. Distinct lncRNA transcriptional fingerprints characterize progressive stages of multiple myeloma. Oncotarget. 7 (12), 14814-14830 (2016).
- Wong, K. Y., et al. Epigenetic silencing of a long non-coding RNA KIAA0495 in multiple myeloma. Molecular Cancer. 14, 175 (2015).
- Schmidt, L. H., et al. The long noncoding MALAT-1 RNA indicates a poor prognosis in non-small cell lung cancer and induces migration and tumor growth. Journal of Thoracic Oncology. 6 (12), 1984-1992 (2011).
- Ji, P., et al. MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer. Oncogene. 22 (39), 8031-8041 (2003).
- Luo, J. H., et al. Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas. Hepatology. 44 (4), 1012-1024 (2006).
- Guffanti, A., et al. A transcriptional sketch of a primary human breast cancer by 454 deep sequencing. BMC Genomics. 10, 163 (2009).
- Cho, S. F., et al. MALAT1 long non-coding RNA is overexpressed in multiple myeloma and may serve as a marker to predict disease progression. BMC Cancer. 14, 809 (2014).
- Handa, H., et al. Long non-coding RNA MALAT1 is an inducible stress response gene associated with extramedullary spread and poor prognosis of multiple myeloma. British Journal of Haematology. 179 (3), 449-460 (2017).
- Hu, Y., et al. Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma. Leukemia. , (2018).
- Lennox, K. A., Behlke, M. A. Cellular localization of long non-coding RNAs affects silencing by RNAi more than by antisense oligonucleotides. Nucleic Acids Research. 44 (2), 863-877 (2016).
- Kam, N. W., O’Connell, M., Wisdom, J. A., Dai, H. Carbon nanotubes as multifunctional biological transporters and near-infrared agents for selective cancer cell destruction. Proceedings of the National Academy of Sciences of the United States of America. 102 (33), 11600-11605 (2005).
- Zeineldin, R., Al-Haik, M., Hudson, L. G. Role of polyethylene glycol integrity in specific receptor targeting of carbon nanotubes to cancer cells. Nano Letters. 9 (2), 751-757 (2009).
- Amodio, N., D’Aquila, P., Passarino, G., Tassone, P., Bellizzi, D. Epigenetic modifications in multiple myeloma: recent advances on the role of DNA and histone methylation. Expert Opinion on Therapeutic Targets. 21 (1), 91-101 (2017).
- Ahmad, N., Haider, S., Jagannathan, S., Anaissie, E., Driscoll, J. J. MicroRNA theragnostics for the clinical management of multiple myeloma. Leukemia. 28 (4), 732-738 (2014).
- Amodio, N., et al. Drugging the lncRNA MALAT1 via. LNA gapmeR ASO inhibits gene expression of proteasome subunits and triggers anti-multiple myeloma activity. Leukemia. , (2018).
- Highleyman, L. FDA approves fomivirsen, famciclovir, and Thalidomide. Food and Drug Administration. BETA. 5, (1998).
- Smith, R. J., Hiatt, W. R. Two new drugs for homozygous familial hypercholesterolemia: managing benefits and risks in a rare disorder. JAMA Internal Medicine. 173 (16), 1491-1492 (2013).
- Aartsma-Rus, A. FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides. Nucleic Acid Therapeutics. 27 (2), 67-69 (2017).
- Nelson, S. F., Miceli, M. C. FDA Approval of Eteplirsen for Muscular Dystrophy. The Journal of the American Medical Association. 317 (14), 1480 (2017).
- Liu, Z., Sun, X., Nakayama-Ratchford, N., Dai, H. Supramolecular chemistry on water-soluble carbon nanotubes for drug loading and delivery. American Chemical Society Nano. 1 (1), 50-56 (2007).
- Ali-Boucetta, H., et al. Multiwalled carbon nanotube-doxorubicin supramolecular complexes for cancer therapeutics. Chemical communications (Cambridge). (4), 459-461 (2008).
- Bianco, A., Kostarelos, K., Partidos, C. D., Prato, M. Biomedical applications of functionalised carbon nanotubes. Chemical communications. (5), 571-577 (2005).
- Hadidi, N., Kobarfard, F., Nafissi-Varcheh, N., Aboofazeli, R. Optimization of single-walled carbon nanotube solubility by noncovalent PEGylation using experimental design methods. International Journal of Nanomedicine. 6, 737-746 (2011).
- Padilla-Parra, S., et al. Quantitative imaging of endosome acidification and single retrovirus fusion with distinct pools of early endosomes. Proceedings of the National Academy of Sciences of the United States of America. 109 (43), 17627-17632 (2012).
- Wu, H., Zhu, L., Torchilin, V. P. pH-sensitive poly(histidine)-PEG/DSPE-PEG co-polymer micelles for cytosolic drug delivery. Biomaterials. 34 (4), 1213-1222 (2013).
- Oishi, M., Nagatsugi, F., Sasaki, S., Nagasaki, Y., Kataoka, K. Smart polyion complex micelles for targeted intracellular delivery of PEGylated antisense oligonucleotides containing acid-labile linkages. Chembiochem. 6 (4), 718-725 (2005).
- Dong, H., Ding, L., Yan, F., Ji, H., Ju, H. The use of polyethylenimine-grafted graphene nanoribbon for cellular delivery of locked nucleic acid modified molecular beacon for recognition of microRNA. Biomaterials. 32 (15), 3875-3882 (2011).
- Arunachalam, B., Phan, U. T., Geuze, H. J., Cresswell, P. Enzymatic reduction of disulfide bonds in lysosomes: characterization of a gamma-interferon-inducible lysosomal thiol reductase (GILT). Proceedings of the National Academy of Sciences of the United States of America. 97 (2), 745-750 (2000).
- Lelimousin, M., Sansom, M. S. Membrane perturbation by carbon nanotube insertion: pathways to internalization. Small. 9 (21), 3639-3646 (2013).
- Thomas, M., Enciso, M., Hilder, T. A. Insertion mechanism and stability of boron nitride nanotubes in lipid bilayers. J Phys Chem B. 119 (15), 4929-4936 (2015).
- Jin, H., Heller, D. A., Strano, M. S. Single-particle tracking of endocytosis and exocytosis of single-walled carbon nanotubes in NIH-3T3 cells. Nano Letters. 8 (6), 1577-1585 (2008).
- Jin, H., Heller, D. A., Sharma, R., Strano, M. S. Size-dependent cellular uptake and expulsion of single-walled carbon nanotubes: single particle tracking and a generic uptake model for nanoparticles. American Chemical Society Nano. 3 (1), 149-158 (2009).
- Ruggiero, A., et al. Paradoxical glomerular filtration of carbon nanotubes. Proceedings of the National Academy of Sciences of the United States of America. 107 (27), 12369-12374 (2010).
