Répression de la croissance de cellules de myélome Multiple In Vivo par Nanotube de carbone monoparoi (NCM)-livré MALAT1 oligonucléotides antisens
Summary
Ce manuscrit décrit la synthèse d’un nanotube de carbone monoparoi (NCM)-conjugué MALAT1 gapmer antisens ADN d’oligonucléotide (SWCNT-anti-MALAT1), qui montre la remise fiable du NCM et le puissant effet thérapeutique de anti-MALAT1 in vitro et in vivo. Méthodes utilisées pour la synthèse, de modification, de conjugaison, et injection de SWCNT-anti-MALAT1 sont décrites.
Abstract
Le nanotube de carbone monoparoi (NCM) est un nouveau type de nanoparticules, qui a été utilisé pour livrer plusieurs sortes de drogues dans les cellules, tels que des protéines, des oligonucléotides et médicaments à petites molécules synthétiques. Le NCM a dimensions personnalisables, une vaste zone superficielle et peut se lier avec souplesse avec des médicaments par le biais de différentes modifications sur sa surface ; par conséquent, c’est un système idéal pour transporter les médicaments dans les cellules. ARN long non codantes (lncRNAs) est un amas d’ARN non codant plu de 200 nt, qui ne peut pas être traduit en protéine, mais joue un rôle important dans les processus biologiques et physiopathologiques. Associées aux métastases pulmonaires adénocarcinome transcription 1 (MALAT1) est une lncRNA hautement conservée. Il a été démontré que des niveaux plus élevés de MALAT1 concernent le mauvais pronostic de divers cancers, notamment le myélome multiple (MM). Nous avons révélé que MALAT1 régule l’ADN réparation et la mort cellulaire en MM ; ainsi, MALAT1 peut être considéré comme une cible thérapeutique pour MM. Cependant, l’efficience de l’oligo antisens pour inhiber/knockdown MALAT1 in vivo est toujours un problème. Dans cette étude, nous modifier le NCM avec PEG-2000 et conjugué un oligo anti-MALAT1 à elle, tester la livraison de ce composé in vitro, injecter par voie intraveineuse dans un modèle de souris MM disséminé et observer une inhibition significative de la progression de MM, ce qui indique cette SWCNT est une navette de livraison idéal pour anti-MALAT1 gapmer ADN.
Introduction
Le NCM est un nanomatériau roman qui peut fournir différents types de médicaments, comme les acides nucléiques, protéines et petites molécules stablement et efficacement avec la tolérabilité idéale et toxicité minimale1 de la vitro et in vivo2. Un SWCNT fonctionnalisé a grande solubilité de biocompatibilité et de l’eau, peut être utilisé comme un service de navette pour les molécules plus petites et peut transporter pour pénétrer la membrane de la cellule3,4,5.
lncRNAs sont un amas d’ARN (> 200 nt) qui sont transcrits à partir du génome à l’ARNm, mais ne peut pas être traduit en protéines. Augmentant la preuve a démontré que les lncRNAs participent à la régulation de l’ expression de gène6 et sont impliqués dans l’apparition et la progression de la plupart des types de cancer, y compris MM7,8,9. MALAT1 est une transcription non codante nucléaire enrichi 2 (NEAT2) et un lncRNA hautement conservée10. MALAT1 est initialement reconnu métastatique pulmonaire non à petites cellules (NSCLC) le cancer11, mais a été surexprimé dans nombreuses tumeurs5,12,13; Il est l’un de le lncRNAs plus fortement exprimée et est corrélé à un mauvais pronostic en MM8,14. Le niveau d’expression de MALAT1 est significativement plus élevé chez les cours fatal extramédullaire MM par rapport à ceux diagnostiqués uniquement sous la forme MM15.
Dans une étude précédente, nous avons confirmé qu’anti-MALAT1 oligos conduire fermement pour dommages à l’ADN et l’apoptose dans MM16 en utilisant des oligonucléotides antisens d’ADN gapmer ciblage MALAT1 (anti-MALAT1) dans les cellules MM. L’ADN de gapmer est composé d’ADN antisens et relié par 2′-OMe-ARN, qui pourrait inciter un clivage MALAT1 par la RNase H activité liée une fois17. L’efficacité de livraison in vivo des oligonucléotides antisens limite toujours son utilisation clinique.
Pour tester la livraison effet de SWCNT pour anti-MALAT1 gapmer oligos, l’anti-MALAT1 gapmer ADN est conjugué à la DSPE-PEG2000-amine fonctionnalisés NCM. Le NCM-anti-MALAT1 est ensuite injectée par voie intraveineuse dans un modèle de souris disséminée MM ; On observe une inhibition frappante après quatre traitements.
Protocol
Representative Results
Discussion
Preuve a démontré que les lncRNAs participent à la régulation de nombreuses procédures physiologiques et physiopathologiques dans les cancers, y compris MM7,8,9; Ils ont le potentiel d’être la cible pour le traitement du cancer, qui peut être réalisé par oligonucléotides antisens20,21,22. La U.S. Food and la Drug Administrat…
Divulgazioni
The authors have nothing to disclose.
Acknowledgements
Les auteurs remercient l’Institut de recherche Lerner de protéomique, génomique et carottes d’imagerie pour leur aide et soutien. Financement : Ce travail a été soutenu financièrement par subvention de NIH/NCI R00 CA172292 (pour J.J.Z.) et fonds d’amorçage (à J.J.Z.) et la clinique et translationnelle Science Collaborative (CNTC) de la Case Western Reserve University Core utilisation pilote Grant (à J.J.Z.). Ce travail a utilisé le microscope confocal Leica SP8 qui a été acheté grâce à un financement des instituts nationaux de santé SIG grant 1S10OD019972-01.
Materials
| SWCNTs | Millipore-Sigma | 704113 | |
| DSPE-PEG2000-Amine | Avanti Polar Lipids | 880128 | |
| bath sonicator | VWR | 97043-992 | |
| 4 mL centrifugal filter | Millipore-Sigma | Z740208-8EA | |
| UV/VIS spectrometer | Thermo Fisher Scientific | accuSkan GO UV/Vis Microplate Spectrophotometer | extinction coefficient of 0.0465 L/mg/cm at 808 nm |
| Sulfo-LC-SPDP | ProteoChem | c1118 | |
| DTT solution | Millipore-Sigma | 43815 | |
| NAP-5 column | GE Healthcare | 17-0853-01 | |
| in vivo imaging system | PerkinElmer | ||
| NOD.CB17-Prkdcscid/J mice | Charles River lab | 250 | |
| Flow cytometer | Becton Dickinso | ||
| Lipofectamine | Invitrogen | 11668019 | Lipofectamine2000 |
| Fetal bovine serum (FBS) | Invitrogen | 10437-028 | |
| RMPI-1640 medium | Invitrogen | 11875-093 | |
| MALAT1-QF: | synthesized by IDT Company | 5’- GTTCTGATCCCGCTGCTATT – 3’ | |
| MALAT1-QR: | synthesized by IDT Company | 5’- TCCTCAACACTCAGCCTTTATC – 3’ | |
| GAPDH-QF: | synthesized by IDT Company | 5’- CAAGAGCACAAGAGGAAGAGAG – 3’ | |
| GAPDH-QR: | synthesized by IDT Company | 5’- CTACATGGCAACTGTGAGGAG – 3’ | |
| Quantitative PCR using SYBR Green PCR master mix | Thermo Fisher Scientific | A25780 | |
| RevertAid first-stand cDNA synthesis kit | Thermo Fisher Scientific | K1621 | |
| anti-MALAT1 | synthesized by IDT Company | 5’-mC*mG*mA*mA*mA*C*A*T*T *G*G*C*A*C*A*mC*mA*mG*mC*mA-3’ |
|
| Cell Viability Assay Kit | Promega Corporation | G7570 | CellTiter-GloLuminescent Cell Viability Assay Kit |
| accuSkan GO UV/Vis Microplate Spectrophotometer | Thermo Fisher Scientific | ||
| centrifugal filter | Millipore-Sigma | UFC910008 | |
| SPSS software | IBM | version 24.0 | |
| D-Luciferin | Millipore-Sigma | L9504 |
Riferimenti
- Jiang, X., et al. RNase non-sensitive and endocytosis independent siRNA delivery system: delivery of siRNA into tumor cells and high efficiency induction of apoptosis. Nanoscale. 5 (16), 7256-7264 (2013).
- Murakami, T., et al. Water-dispersed single-wall carbon nanohorns as drug carriers for local cancer chemotherapy. Nanomedicine (Lond). 3 (4), 453-463 (2008).
- Kam, N. W., Dai, H. Carbon nanotubes as intracellular protein transporters: generality and biological functionality. Journal of the American Chemical Society. 127 (16), 6021-6026 (2005).
- Kam, N. W., Liu, Z., Dai, H. Functionalization of carbon nanotubes via. cleavable disulfide bonds for efficient intracellular delivery of siRNA and potent gene silencing. Journal of the American Chemical Society. 127 (36), 12492-12493 (2005).
- Kam, N. W., Liu, Z., Dai, H. Carbon nanotubes as intracellular transporters for proteins and DNA: an investigation of the uptake mechanism and pathway. Angewandte Chemie International Edition in English. 45 (4), 577-581 (2006).
- Ntziachristos, P., Abdel-Wahab, O., Aifantis, I. Emerging concepts of epigenetic dysregulation in hematological malignancies. Nature Immunology. 17 (9), 1016-1024 (2016).
- Evans, J. R., Feng, F. Y., Chinnaiyan, A. M. The bright side of dark matter: lncRNAs in cancer. Journal of Clinical Investigation. 126 (8), 2775-2782 (2016).
- Ronchetti, D., et al. Distinct lncRNA transcriptional fingerprints characterize progressive stages of multiple myeloma. Oncotarget. 7 (12), 14814-14830 (2016).
- Wong, K. Y., et al. Epigenetic silencing of a long non-coding RNA KIAA0495 in multiple myeloma. Molecular Cancer. 14, 175 (2015).
- Schmidt, L. H., et al. The long noncoding MALAT-1 RNA indicates a poor prognosis in non-small cell lung cancer and induces migration and tumor growth. Journal of Thoracic Oncology. 6 (12), 1984-1992 (2011).
- Ji, P., et al. MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer. Oncogene. 22 (39), 8031-8041 (2003).
- Luo, J. H., et al. Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas. Hepatology. 44 (4), 1012-1024 (2006).
- Guffanti, A., et al. A transcriptional sketch of a primary human breast cancer by 454 deep sequencing. BMC Genomics. 10, 163 (2009).
- Cho, S. F., et al. MALAT1 long non-coding RNA is overexpressed in multiple myeloma and may serve as a marker to predict disease progression. BMC Cancer. 14, 809 (2014).
- Handa, H., et al. Long non-coding RNA MALAT1 is an inducible stress response gene associated with extramedullary spread and poor prognosis of multiple myeloma. British Journal of Haematology. 179 (3), 449-460 (2017).
- Hu, Y., et al. Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma. Leukemia. , (2018).
- Lennox, K. A., Behlke, M. A. Cellular localization of long non-coding RNAs affects silencing by RNAi more than by antisense oligonucleotides. Nucleic Acids Research. 44 (2), 863-877 (2016).
- Kam, N. W., O’Connell, M., Wisdom, J. A., Dai, H. Carbon nanotubes as multifunctional biological transporters and near-infrared agents for selective cancer cell destruction. Proceedings of the National Academy of Sciences of the United States of America. 102 (33), 11600-11605 (2005).
- Zeineldin, R., Al-Haik, M., Hudson, L. G. Role of polyethylene glycol integrity in specific receptor targeting of carbon nanotubes to cancer cells. Nano Letters. 9 (2), 751-757 (2009).
- Amodio, N., D’Aquila, P., Passarino, G., Tassone, P., Bellizzi, D. Epigenetic modifications in multiple myeloma: recent advances on the role of DNA and histone methylation. Expert Opinion on Therapeutic Targets. 21 (1), 91-101 (2017).
- Ahmad, N., Haider, S., Jagannathan, S., Anaissie, E., Driscoll, J. J. MicroRNA theragnostics for the clinical management of multiple myeloma. Leukemia. 28 (4), 732-738 (2014).
- Amodio, N., et al. Drugging the lncRNA MALAT1 via. LNA gapmeR ASO inhibits gene expression of proteasome subunits and triggers anti-multiple myeloma activity. Leukemia. , (2018).
- Highleyman, L. FDA approves fomivirsen, famciclovir, and Thalidomide. Food and Drug Administration. BETA. 5, (1998).
- Smith, R. J., Hiatt, W. R. Two new drugs for homozygous familial hypercholesterolemia: managing benefits and risks in a rare disorder. JAMA Internal Medicine. 173 (16), 1491-1492 (2013).
- Aartsma-Rus, A. FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides. Nucleic Acid Therapeutics. 27 (2), 67-69 (2017).
- Nelson, S. F., Miceli, M. C. FDA Approval of Eteplirsen for Muscular Dystrophy. The Journal of the American Medical Association. 317 (14), 1480 (2017).
- Liu, Z., Sun, X., Nakayama-Ratchford, N., Dai, H. Supramolecular chemistry on water-soluble carbon nanotubes for drug loading and delivery. American Chemical Society Nano. 1 (1), 50-56 (2007).
- Ali-Boucetta, H., et al. Multiwalled carbon nanotube-doxorubicin supramolecular complexes for cancer therapeutics. Chemical communications (Cambridge). (4), 459-461 (2008).
- Bianco, A., Kostarelos, K., Partidos, C. D., Prato, M. Biomedical applications of functionalised carbon nanotubes. Chemical communications. (5), 571-577 (2005).
- Hadidi, N., Kobarfard, F., Nafissi-Varcheh, N., Aboofazeli, R. Optimization of single-walled carbon nanotube solubility by noncovalent PEGylation using experimental design methods. International Journal of Nanomedicine. 6, 737-746 (2011).
- Padilla-Parra, S., et al. Quantitative imaging of endosome acidification and single retrovirus fusion with distinct pools of early endosomes. Proceedings of the National Academy of Sciences of the United States of America. 109 (43), 17627-17632 (2012).
- Wu, H., Zhu, L., Torchilin, V. P. pH-sensitive poly(histidine)-PEG/DSPE-PEG co-polymer micelles for cytosolic drug delivery. Biomaterials. 34 (4), 1213-1222 (2013).
- Oishi, M., Nagatsugi, F., Sasaki, S., Nagasaki, Y., Kataoka, K. Smart polyion complex micelles for targeted intracellular delivery of PEGylated antisense oligonucleotides containing acid-labile linkages. Chembiochem. 6 (4), 718-725 (2005).
- Dong, H., Ding, L., Yan, F., Ji, H., Ju, H. The use of polyethylenimine-grafted graphene nanoribbon for cellular delivery of locked nucleic acid modified molecular beacon for recognition of microRNA. Biomaterials. 32 (15), 3875-3882 (2011).
- Arunachalam, B., Phan, U. T., Geuze, H. J., Cresswell, P. Enzymatic reduction of disulfide bonds in lysosomes: characterization of a gamma-interferon-inducible lysosomal thiol reductase (GILT). Proceedings of the National Academy of Sciences of the United States of America. 97 (2), 745-750 (2000).
- Lelimousin, M., Sansom, M. S. Membrane perturbation by carbon nanotube insertion: pathways to internalization. Small. 9 (21), 3639-3646 (2013).
- Thomas, M., Enciso, M., Hilder, T. A. Insertion mechanism and stability of boron nitride nanotubes in lipid bilayers. J Phys Chem B. 119 (15), 4929-4936 (2015).
- Jin, H., Heller, D. A., Strano, M. S. Single-particle tracking of endocytosis and exocytosis of single-walled carbon nanotubes in NIH-3T3 cells. Nano Letters. 8 (6), 1577-1585 (2008).
- Jin, H., Heller, D. A., Sharma, R., Strano, M. S. Size-dependent cellular uptake and expulsion of single-walled carbon nanotubes: single particle tracking and a generic uptake model for nanoparticles. American Chemical Society Nano. 3 (1), 149-158 (2009).
- Ruggiero, A., et al. Paradoxical glomerular filtration of carbon nanotubes. Proceedings of the National Academy of Sciences of the United States of America. 107 (27), 12369-12374 (2010).
