Her præsenterer vi en protokol for menneskelige Dental Pulp stamceller isoleret og formering for at evaluere udtrykket prion protein under neuronal differentiering proces.
Bioetiske spørgsmål relateret til manipulation af embryonale stamceller har hindret fremskridt inden for medicinsk forskning. Derfor er det meget vigtigt at få stamceller fra forskellige væv, såsom fedt, navlestreng, knoglemarv og blod. Blandt de mulige kilder er dental pulp særlig interessant, fordi det er let at opnå for bioetiske overvejelser. Menneskelige Dental Pulp stamceller (hDPSCs) er en type af voksne stamceller købedygtig adskille i neuronal-lignende celler og kan fås fra den tredje molar af raske patienter (13-19 aldre). Især blev af dental pulp fjernet med en gravemaskine, skæres i små skiver, behandlet med collagenase IV og kulturperler i en kolbe. For at fremkalde de neuronal differentiering, blev hDPSCs stimuleret med EGF/bFGF for 2 uger. Vi har tidligere demonstreret, at differentiering proces indholdet af cellulære prion Protein (PrPC) i hDPSCs steg. Cytofluorimetric Analysen viste en tidlig udtryk for PrPC at øget efter neuronal differentiering proces. Ablation af PrPC af siRNA PrP forhindret neuronal differentiering induceret af EGF/bFGF. I dette papir illustrere vi, at som vi øget isolation, adskillelse og in vitro- dyrkningsmetoder af hDPSCs med flere nemme procedurer, mere effektiv celle kloner var fremstillet og storstilet udbygning af mesenchymale stamceller (msc) der blev observeret. Vi viser også, hvordan hDPSCs, fremstillet med metoderne beskrevet i protokollen, er en fremragende eksperimentel model til at studere den neuronal differentiering MSCs og efterfølgende cellulære og molekylære processer.
Mesenkymale stamceller er isoleret fra flere væv, herunder knoglemarv, navlestrengsblod, menneskelige dental pulp, fedtvæv og blod1,2,3,4,5 , 6. som rapporteret af flere forfattere, hDPSCs Vis plast overholdelse, en typisk fibroblast-lignende morfologi. Disse repræsenterer en meget heterogene befolkning med forskellige kloner og forskelle i proliferativ og differentiering kapacitet7,8. hDPSCs express specifikke markører for mesenkymale stamceller (dvs. CD44, CD90, CD73, CD105, STRØ-1), de er negative for nogle hæmatopoietisk markører (såsom CD14 og CD19) og er i stand til at in vitro-multilineage differentiering9, 10,11.
Flere forfattere har vist, at disse celler er i stand til at differentiere i neuron-lignende celler ved hjælp af forskellige protokoller, der omfatter tilføjelse af NGF, bFGF, EGF i kombination med den specifikke medier og kosttilskud7,12. Også, mange proteiner er involveret under neuronal differentiering proces, og blandt disse, flere papirer fremvise relevant rolle og betydelige udtryk af cellulære prionprotein (PrPC), begge i embryonale og voksne stamceller13, 14. PrPC repræsenterer en pleiotrope molekyle i stand til at udføre forskellige funktioner inde i cellerne som kobber metabolisme, apoptose, og modstand mod oxidativ stress15,16,17 , 18 , 19 , 20 , 21 , 22.
I vores tidligere papir23undersøgte vi rollen som PrPC i hDPSCs neuronal differentiering proces. Faktisk, hDPSCs express precociously PrPC , og efter neuronal differentiering, det var muligt at observere en yderligere stigning. Andre forfattere hypotese en mulig rolle for PrPC ved neuronal differentiering af stamceller. Faktisk, PrPC drev differentiering af humane embryonale stamceller i neuroner, oligodendrocytes og astrocytter24. Formålet med denne undersøgelse var at understrege metoden for at få stamceller fra dental pulp, dens differentiering proces og rollen af PrPC under neuronal differentiering.
I dette arbejde fokuseret vi på metoder til isolering og neuronal differentiering af hDPSCs; Desuden evalueres vi rollen som PrPC i denne proces. Der er flere metoder til at isolere og differentiere hDPSCs i neuron-lignende celler, og kritiske trin i processen. hDPSCs er i stand til at differentiere i flere slægter som chondroblasts, adipocytter, osteoblaster og neuroner. I vores papir undersøgte vi mekanismerne af neuronal differentiering og tilstedeværelsen af PrPC. Som omtalt ovenfor, udtrykk…
The authors have nothing to disclose.
Dette arbejde blev støttet af “Fondazione Varrone” og Rieti Universitet Hub “Sabina Universitas” til Vincenzo Mattei.
Figur 5 (A, B) genoptrykt med tilladelse fra udgiveren Taylor & Francis Ltd fra: rolle af Prion-protein-EGFR multimolecular kompleks under neuronal differentiering af humane dental pulp-afledte stamceller. Martellucci, S., Manganelli V., Santacroce C., Santilli F., Piccoli L., Sorice M., Mattei V. prioner. 2018 Mar 4. Taylor & Francis Ltd.
Amphotericin B solution | Sigma-Aldrich | A2942 | It is use to supplement cell culture media, it is a polyene antifungal antibiotic from Streptomyce |
Anti-B3tubulin | Cell Signaling Technology | #4466 | One of six B-tubulin isoform, it is expressed highly during fetal and postnatal development, remaining high in the peripheral nervous system |
Anti-CD105 | BD Biosciences | 611314 | Endoglin (CD105), a major glycoprotein of human vascular endothelium, is a type I integral membrane protein with a large extracellular region, a hydrophobic transmembrane region, and a short cytoplasmic tail |
Anti-CD44 | Millipore | CBL154-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
Anti-CD73 | Cell Signaling Technology | 13160 | CD73 is a 70 kDa glycosyl phosphatidylinositol-anchored, membrane-bound glycoprotein that catalyzes the hydrolysis of extracellular nucleoside monophosphates into bioactive nucleosides |
Anti-CD90 | Millipore | CBL415-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
Anti-GAP43 | Cell Signaling Technology | #8945 | Is a nervous system specific, growth-associated protein in growth cones and areas of high plasticity |
Anti-mouse PE | Abcam | ab7003 | Is an antibody used in in flow cytometry or FACS analysis |
Anti-NFH | Cell Signaling Technology | #2836 | Is an antibody that detects endogenous levels of total Neurofilament-H protein |
Anti-PrP mAb EP1802Y | Abcam | ab52604 | Rabbit monoclonal [EP 1802Y] to Prion protein PrP |
Anti-rabbit CY5 | Abcam | ab6564 | Is an antibody used in in flow cytometry or FACS analysis |
Anti-STRO 1 | Millipore | MAB4315-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
B27 Supp XF CTS | Gibco by life technologies | A14867-01 | B-27 can be used to support induction of human neural stem cells (hNSCs) from pluripotent stem cells (PSCs), expansion of hNSCs, differentiation of hNSCs, and maintenance of mature differentiated neurons in culture |
BD Accuri C6 flow cytometer | BD Biosciences | AC6531180187 | Flow cytometer equipped with a blue laser (488 nm) and a red laser (640 nm) |
BD Accuri C6 Software | BD Biosciences | Controls the BD Accuri C6 flow cytometer system in order to acquire data, generate statistics, and analyze results | |
bFGF | PeproThec, DBA | 100-18B | basic Fibroblast Growth Factor |
Centrifuge CL30R | Termo fisher Scientific | 11210908 | it is a device that is used for the separation of fluids,gas or liquid, based on density |
CO2 Incubator 3541 | Termo fisher Scientific | 317527-185 | it ensures optimal and reproducible growth conditions for cell cultures |
Collagenase, type IV | Life Technologies | 17104019 | Collagenase is a protease that cleaves the bond between a neutral amino acid (X) and glycine in the sequence Pro-X-Glyc-Pro, which is found with high frequency in collagen |
Disposable scalpel | Swann-Morton | 501 | It is use to cut tissues |
DMEM-L | Euroclone | ECM0060L | Dulbecco's Modified Eagle's Medium Low Glucose with L-Glutamine with Sodium Pyruvate |
EGF | PeproThec, DBA | AF-100-15 | Epidermal Growth Factor |
Fetal Bovine Serum | Gibco by life technologies | 10270-106 | FBS is a popular media supplement because it provides a wide array of functions in cell culture. FBS delivers nutrients, growth and attachment factors and protects cells from oxidative damage and apoptosis by mechanisms that are difficult to reproduce in serum-free media (SFM) systems |
Filtropur BT50 0.2,500ml Bottle top filter | Sarstedt | 831,823,101 | it is a device that is used for filtration of solutions |
Flexitube GeneSolution for PRNP | Qiagen | GS5621 | 4 siRNAs for Entrez gene 5621. Target sequence N.1 TAGAGATTTCATAGCTATTTA N.2 CAGCAAATAACCATTGGTTAA N.3. CTGAATCGTTTCATGTAAGAA N.4 CAGTGACTATGAGGACCGTTA |
Hank's solution 1x | Gibco by life technologies | 240200083 | The essential function of Hanks′ Balanced Salt solution is to maintain pH as well as osmotic balance. It also provides water and essential inorganic ions to cells |
HiPerFect Transfection Reagent | Qiagen | 301705 | HiPerFect Transfection Reagent is a unique blend of cationic and neutral lipids that enables effective siRNA uptake and efficient release of siRNA inside cells, resulting in high gene knockdown even when using low siRNA concentrations |
Neurobasal A | Gibco by life technologies | 10888022 | Neurobasal-A Medium is a basal medium designed for long-term maintenance and maturation of pure post-natal and adult brain neurons |
Paraformaldehyde | Sigma-Aldrich | 30525-89-4 | Paraformaldehyde has been used for fixing of cells and tissue sections during staining procedures |
penicillin/streptomycin | Euroclone | ECB3001D | It is use to supplement cell culture media to control bacterial contamination |
Phosphate buffered saline (PBS) | Euroclone | ECB4004LX10 | PBS is a balanced salt solution used for the handling and culturing of mammalian cells. PBS is used to to irrigate, wash, and dilute mammalian cells. Phosphate buffering maintains the pH in the physiological range |
TC-Platte 6 well, Cell+,F | Sarstedt | 833,920,300 | It is a growth surface for adherent cells |
Tissue culture flask T-25,Cell+,Vented Cap | Sarstedt | 833,910,302 | Tissue culture flask T-25, polystyrene, Cell+ growth surface for sensitive adherent cells, e.g. primary cells, canted neck, ventilation cap, yellow, sterile, Pyrogen-free, non-cytotoxic, 10 pcs./bag |
Triton X-100 | Sigma-Aldrich | 9002-93-1 | Widely used non-ionic surfactant for recovery of membrane components under mild non-denaturing conditions |
Trypsin-EDTA | Euroclone | ECB3052D | Trypsin will cleave peptides on the C-terminal side of lysine and arginine amino acid residues. Trypsin is used to remove adherent cells from a culture surface |
Tube | Sarstedt | 62,554,502 | Tube 15ml, 120x17mm, PP |
VBH 36 C2 Compact | Steril | ST-003009000 | Offers totally protection for the enviroment and worker |
ZEISS Axio Vert.A1 – Inverted Microscope | Zeiss | 3849000962 | ZEISS Axio Vert.A1 provides a unique entry level price and can provide all contrasting techniques, including brightfield, phase contrast, PlasDIC, VAREL, improved Hoffman Modulation Contrast (iHMC), DIC and fluorescence. Incorporate LED illumination for gentle imaging for fluorescently-labeled cells. Axio Vert.A1 is ergonomically designed for routine work and compact enough to sit inside tissue culture hoods. |