Aislamiento, propagación y expresión de la proteína del prión durante la diferenciación Neuronal de células madre de pulpa Dental humana
Summary
Aquí presentamos un protocolo para aislamiento de células de la pulpa Dental humana y propagación con el fin de evaluar la expresión de la proteína del prión durante el proceso de diferenciación neuronal.
Abstract
Cuestiones bioéticas relacionadas con la manipulación de células madre embrionarias han impedido avances en el campo de la investigación médica. Por esta razón, es muy importante obtener las células madre adultas de diferentes tejidos como el adiposo, cordón umbilical, médula ósea y sangre. Entre las posibles fuentes, la pulpa dental es particularmente interesante porque es fácil de obtener con respecto a consideraciones bioéticas. De hecho, células de madre pulpa Dental humana (hDPSCs) son un tipo de células madre adultas capaces de diferenciarse en células neuronales y puede obtenerse desde el tercer molar de pacientes sanos (edades de 13-19). En particular, la pulpa dental elimina con una excavadora, cortar en pequeñas rodajas, trataron con colagenasa IV y cultivada en un matraz. Para inducir la diferenciación neuronal, hDPSCs fueron estimuladas con EGF/bFGF durante 2 semanas. Previamente, hemos demostrado que durante el proceso de diferenciación del contenido de priónica celular proteína (PrPC) en hDPSCs aumentado. El análisis cytofluorimetric mostró una expresión temprana de PrPC que aumentó después del proceso de diferenciación neuronal. Ablación de PrPC por siRNA PrP previene la diferenciación neuronal inducida por EGF/bFGF. En este artículo ilustramos que mejoramos el aislamiento, separación y en vitro métodos de cultivo de hDPSCs con varios procedimientos fáciles, más eficientes células clones eran obtenido y gran expansión de las células madre mesenquimales (MSCs) se observó. También mostramos cómo hDPSCs, obtenidos con métodos detallados en el protocolo, son un excelente modelo experimental para estudiar el proceso de diferenciación neuronal de MSCs y los procesos celulares y moleculares posteriores.
Introduction
Las células madre mesenquimales se han aislado de varios tejidos, incluyendo la médula ósea, sangre del cordón umbilical, la pulpa dental humana, tejido adiposo y sangre1,2,3,4,5 , 6. según varios autores, hDPSCs Mostrar adhesión de plástico, una típica morfología de fibroblasto-como. Estos representan una población muy heterogénea con diferentes clones y diferencias en la capacidad proliferativa y de diferenciación7,8. hDPSCs expresan marcadores específicos de células madre mesenquimales (es decir, CD44, CD90, CD73, CD105, STRO-1), son negativos para algunos marcadores hematopoyéticos (como CD14 y CD19) y son capaces de diferenciación in vitro del multilineage9, 10,11.
Varios autores han demostrado que estas células son capaces de diferenciarse en neuronas-como las células utilizando diferentes protocolos, que incluyen la adición de NGF, bFGF, EGF en combinación con determinados medios y suplementos de7,12. Además, muchas proteínas están involucradas durante el proceso de diferenciación neuronal y, entre estos, varios trabajos muestran un papel relevante y significativa expresión de la proteína priónica celular (PrPC), tanto en las células madre embrionarias y adultas13, 14. PrPC representa una molécula pleiotrópica capaz de realizar diferentes funciones dentro de las células como cobre metabolismo, apoptosis, y resistencia a oxidativo estrés15,16,17 , 18 , 19 , 20 , 21 , 22.
En nuestro anterior documento23, investigamos el papel de PrPC en el proceso de diferenciación neuronal hDPSCs. De hecho, hDPSCs expresar precozmente PrPC y, después de la diferenciación neuronal, fue posible observar un aumento adicional. Otros autores la hipótesis de un posible papel del PrPC en los procesos de diferenciación neuronal de células madre. De hecho, PrPC conduce a la diferenciación de células madre embrionarias humanas en neuronas, oligodendrocitos y astrocitos24. El propósito de este estudio era hacer hincapié en la metodología para la obtención de células madre de pulpa dental, su proceso de diferenciación y la función de PrPC durante la diferenciación neuronal.
Protocol
Representative Results
Discussion
En este trabajo, nos enfocamos en la metodología para el aislamiento y la diferenciación neuronal de hDPSCs; Además, evaluamos el papel del PrPC en este proceso. Existen varios métodos para aislar y diferenciar hDPSCs neurona-como las células y pasos críticos durante el proceso. hDPSCs son capaces de diferenciarse en varios linajes como condroblastos, adipocitos, osteoblastos y las neuronas. En nuestro trabajo, hemos investigado los mecanismos de la diferenciación neuronal y la presencia de PrPC</s…
Divulgazioni
The authors have nothing to disclose.
Acknowledgements
Este trabajo fue apoyado por la “Fondazione Varrón” y Rieti Universidad “Sabina Universitas” a Vincenzo Mattei.
Figura 5 (A, B) reimpreso con el permiso de la editorial Taylor & Francis Ltd de: complejos multimoleculares de papel de prión proteína EGFR durante la diferenciación neuronal de dentales pulpa derivada de células madre humanas. Martellucci, S., V. de Manganelli, Santacroce C. F. Santilli, L. Piccoli, M. Sorice, V. Mattei prión. 2018 4 de Mar. Taylor & Francis Ltd.
Materials
| Amphotericin B solution | Sigma-Aldrich | A2942 | It is use to supplement cell culture media, it is a polyene antifungal antibiotic from Streptomyce |
| Anti-B3tubulin | Cell Signaling Technology | #4466 | One of six B-tubulin isoform, it is expressed highly during fetal and postnatal development, remaining high in the peripheral nervous system |
| Anti-CD105 | BD Biosciences | 611314 | Endoglin (CD105), a major glycoprotein of human vascular endothelium, is a type I integral membrane protein with a large extracellular region, a hydrophobic transmembrane region, and a short cytoplasmic tail |
| Anti-CD44 | Millipore | CBL154-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
| Anti-CD73 | Cell Signaling Technology | 13160 | CD73 is a 70 kDa glycosyl phosphatidylinositol-anchored, membrane-bound glycoprotein that catalyzes the hydrolysis of extracellular nucleoside monophosphates into bioactive nucleosides |
| Anti-CD90 | Millipore | CBL415-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
| Anti-GAP43 | Cell Signaling Technology | #8945 | Is a nervous system specific, growth-associated protein in growth cones and areas of high plasticity |
| Anti-mouse PE | Abcam | ab7003 | Is an antibody used in in flow cytometry or FACS analysis |
| Anti-NFH | Cell Signaling Technology | #2836 | Is an antibody that detects endogenous levels of total Neurofilament-H protein |
| Anti-PrP mAb EP1802Y | Abcam | ab52604 | Rabbit monoclonal [EP 1802Y] to Prion protein PrP |
| Anti-rabbit CY5 | Abcam | ab6564 | Is an antibody used in in flow cytometry or FACS analysis |
| Anti-STRO 1 | Millipore | MAB4315-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
| B27 Supp XF CTS | Gibco by life technologies | A14867-01 | B-27 can be used to support induction of human neural stem cells (hNSCs) from pluripotent stem cells (PSCs), expansion of hNSCs, differentiation of hNSCs, and maintenance of mature differentiated neurons in culture |
| BD Accuri C6 flow cytometer | BD Biosciences | AC6531180187 | Flow cytometer equipped with a blue laser (488 nm) and a red laser (640 nm) |
| BD Accuri C6 Software | BD Biosciences | Controls the BD Accuri C6 flow cytometer system in order to acquire data, generate statistics, and analyze results | |
| bFGF | PeproThec, DBA | 100-18B | basic Fibroblast Growth Factor |
| Centrifuge CL30R | Termo fisher Scientific | 11210908 | it is a device that is used for the separation of fluids,gas or liquid, based on density |
| CO2 Incubator 3541 | Termo fisher Scientific | 317527-185 | it ensures optimal and reproducible growth conditions for cell cultures |
| Collagenase, type IV | Life Technologies | 17104019 | Collagenase is a protease that cleaves the bond between a neutral amino acid (X) and glycine in the sequence Pro-X-Glyc-Pro, which is found with high frequency in collagen |
| Disposable scalpel | Swann-Morton | 501 | It is use to cut tissues |
| DMEM-L | Euroclone | ECM0060L | Dulbecco's Modified Eagle's Medium Low Glucose with L-Glutamine with Sodium Pyruvate |
| EGF | PeproThec, DBA | AF-100-15 | Epidermal Growth Factor |
| Fetal Bovine Serum | Gibco by life technologies | 10270-106 | FBS is a popular media supplement because it provides a wide array of functions in cell culture. FBS delivers nutrients, growth and attachment factors and protects cells from oxidative damage and apoptosis by mechanisms that are difficult to reproduce in serum-free media (SFM) systems |
| Filtropur BT50 0.2,500ml Bottle top filter | Sarstedt | 831,823,101 | it is a device that is used for filtration of solutions |
| Flexitube GeneSolution for PRNP | Qiagen | GS5621 | 4 siRNAs for Entrez gene 5621. Target sequence N.1 TAGAGATTTCATAGCTATTTA N.2 CAGCAAATAACCATTGGTTAA N.3. CTGAATCGTTTCATGTAAGAA N.4 CAGTGACTATGAGGACCGTTA |
| Hank's solution 1x | Gibco by life technologies | 240200083 | The essential function of Hanks′ Balanced Salt solution is to maintain pH as well as osmotic balance. It also provides water and essential inorganic ions to cells |
| HiPerFect Transfection Reagent | Qiagen | 301705 | HiPerFect Transfection Reagent is a unique blend of cationic and neutral lipids that enables effective siRNA uptake and efficient release of siRNA inside cells, resulting in high gene knockdown even when using low siRNA concentrations |
| Neurobasal A | Gibco by life technologies | 10888022 | Neurobasal-A Medium is a basal medium designed for long-term maintenance and maturation of pure post-natal and adult brain neurons |
| Paraformaldehyde | Sigma-Aldrich | 30525-89-4 | Paraformaldehyde has been used for fixing of cells and tissue sections during staining procedures |
| penicillin/streptomycin | Euroclone | ECB3001D | It is use to supplement cell culture media to control bacterial contamination |
| Phosphate buffered saline (PBS) | Euroclone | ECB4004LX10 | PBS is a balanced salt solution used for the handling and culturing of mammalian cells. PBS is used to to irrigate, wash, and dilute mammalian cells. Phosphate buffering maintains the pH in the physiological range |
| TC-Platte 6 well, Cell+,F | Sarstedt | 833,920,300 | It is a growth surface for adherent cells |
| Tissue culture flask T-25,Cell+,Vented Cap | Sarstedt | 833,910,302 | Tissue culture flask T-25, polystyrene, Cell+ growth surface for sensitive adherent cells, e.g. primary cells, canted neck, ventilation cap, yellow, sterile, Pyrogen-free, non-cytotoxic, 10 pcs./bag |
| Triton X-100 | Sigma-Aldrich | 9002-93-1 | Widely used non-ionic surfactant for recovery of membrane components under mild non-denaturing conditions |
| Trypsin-EDTA | Euroclone | ECB3052D | Trypsin will cleave peptides on the C-terminal side of lysine and arginine amino acid residues. Trypsin is used to remove adherent cells from a culture surface |
| Tube | Sarstedt | 62,554,502 | Tube 15ml, 120x17mm, PP |
| VBH 36 C2 Compact | Steril | ST-003009000 | Offers totally protection for the enviroment and worker |
| ZEISS Axio Vert.A1 – Inverted Microscope | Zeiss | 3849000962 | ZEISS Axio Vert.A1 provides a unique entry level price and can provide all contrasting techniques, including brightfield, phase contrast, PlasDIC, VAREL, improved Hoffman Modulation Contrast (iHMC), DIC and fluorescence. Incorporate LED illumination for gentle imaging for fluorescently-labeled cells. Axio Vert.A1 is ergonomically designed for routine work and compact enough to sit inside tissue culture hoods. |
Riferimenti
- Robey, P. G., Kuznetsov, S. A., Riminucci, M., Bianco, P. Bone marrow stromal cell assays: in vitro and in vivo. Methods in Molecular Biology. 1130, 279-293 (2014).
- Jiang, Y., et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 418, 1-49 (2002).
- Kern, S., Eichler, H., Stoeve, J., Kluter, H., Bieback, K. Comparative analysis of mesenchymal stem cells from bone marrow, umbilical cord blood, or adipose tissue. Stem Cells. 24, 1294-1301 (2006).
- Zannettino, A. C. W., et al. Multi-potential Human adipose-derived stromal stem cells exhibit a perivascular phenotype in vitro and in vivo. Journal of Cellular Physiology. 214, 413-421 (2008).
- Mattei, V., et al. Role of lipid rafts in neuronal differentiation of dental pulp-derived stem cells. Experimental Cell Research. 339, 231-240 (2015).
- Jansen, J., Hanks, S., Thompson, J. M., Dugan, M. J., Akard, L. P. Transplantation of hematopoietic stem cells from the peripheral blood. Journal of Cellular and Molecular Medicine. 9 (1), 37-50 (2005).
- Young, F. I., et al. Clonal heterogeneity in the neuronal and glial differentiation of dental pulp stem/progenitor cells. Stem Cells International. 2016, 1290561 (2016).
- Pisciotta, A., et al. Human dental pulp stem cells (hDPSCs): isolation, enrichment and comparative differentiation of two sub-populations. BMC Developmental Biology. 15, 14 (2015).
- Atari, M., et al. Dental pulp of the third molar: a new source of pluripotent-like stem cells. Journal of Cell Science. 125, 3343-3356 (2012).
- Koyama, N., Okubo, Y., Nakao, K., Bessho, K. Evaluation of pluripotency in human dental pulp cells. Journal of oral and maxillofacial surgery: official journal of the American Association of Oral and Maxillofacial Surgeons. 67, 501-506 (2009).
- Gronthos, S., et al. Stem cell properties of human dental pulp stem cells. Journal of Dental Research. 81, 531-535 (2002).
- Arthur, A., Rychkov, G., Shi, S., Koblar, S. A., Gronthos, S. Adult human dental pulp stem cells differentiate toward functionally active neurons under appropriate environmental cues. Stem Cells. 7, 1787-1795 (2008).
- Lee, Y. J., Baskakov, I. V. The cellular form of the prion protein is involved in controlling cell cycle dynamics, self-renewal, and the fate of human embryonic stem cell differentiation. Journal of Neurochemistry. 124, 310-322 (2013).
- Steele, A. D., Emsley, J. G., Ozdinler, P. H., Lindquist, S., Macklis, J. D. Prion protein (PrPc) positively regulates neural precursor proliferation during developmental and adult mammalian neurogenesis. Proceedings of the National Academy of Sciences of the United States of America. 103, 3416-3421 (2006).
- Wulf, M. A., Senatore, A., Aguzzi, A. The biological function of the cellular prion protein: an update. BMC Biology. 15, 34 (2017).
- Mattei, V., et al. Recruitment of cellular prion protein to mitochondrial raft-like microdomains contributes to apoptosis execution. Molecular Biology of the Cell. 22, 4842-4853 (2011).
- Linden, R. The Biological Function of the Prion Protein: A Cell Surface Scaffold of Signaling Modules. Frontiers in Molecular Neuroscience. 10, 77 (2017).
- Garofalo, T., et al. Role of mitochondrial raft-like microdomains in the regulation of cell apoptosis. Apoptosis. , 621-634 (2015).
- Watt, N. T., et al. Reactive oxygen species-mediated beta-cleavage of the prion protein in the cellular response to oxidative stress. The Journal of Biological Chemistry. 280, 35914-35921 (2005).
- Mattei, V., et al. Morphine Withdrawal Modifies Prion Protein Expression in Rat Hippocampus. PLoS One. 12, 0169571 (2017).
- Hu, W., et al. Prion proteins: physiological functions and role in neurological disorders. Journal of the Neurological Sciences. 264, 1-8 (2008).
- Sorice, M., et al. Trafficking of PrPC to mitochondrial raft-like microdomains during cell apoptosis. Prion. 6, 354-358 (2012).
- Martellucci, S., et al. Role of Prion protein-EGFR multimolecular complex during neuronal differentiation of human dental pulp-derived stem cells. Prion. 12 (2), 117-126 (2018).
- Lee, Y. J., Baskokov, I. V. The cellular form of the prion protein guides the differentiation of human embryonic stem cell into neuron-, oligodendrocyte- and astrocyte-committed lineages. Prion. 8, 266-275 (2014).
- Huang, G. T., Sonoyama, W., Chen, J., Park, S. H. In vitro characterization of human dental pulp cells: various isolation methods and culturing environments. Cell and Tissue Research. 324, 225-236 (2006).
- Suchanek, J., et al. Dental pulp stem cells and their characterization. Biomedical papers of the Medical Faculty of the University Palacký. 153, 31-35 (2009).
- Bressan, E., et al. Donor age-related biological properties of human dental pulp stem cells change in nanostructured scaffolds. PLoS One. 7 (11), 49146 (2012).
