CRISPR/Cas9 시스템을 사용하여 트리파노소마 크루지의 아마스티고테 스테이지에 유전자 녹아웃 직접 도입
Summary
여기에서, 우리는 CRISPR/Cas9 시스템을 사용하여, Trypanosoma cruzi의 세포외 amastigote로 유전자 녹아웃을 소개하는 프로토콜을 기술합니다. 성장 표현형은 축세포 배양의 세포 계수 또는 숙주 세포 침입 후 세포 내 아마스티고테의 증식에 의해 추적될 수 있다.
Abstract
Trypanosoma cruzi는 주로 라틴 아메리카에서 Chagas’ 질병을 일으키는 원인이 되는 병원성 원생 동물 기생충입니다. T. cruzi에대하여 새로운 약 표적을 확인하기 위하여는, 기생충의 포유류 단계에서 표적 유전자의 본질성을 확인하는 것이 중요합니다, amastigote. T. 크루지의 아마스티고테스는 숙주 세포 내부에 복제; 따라서, 다른 발달 단계를 거치지 않고 녹아웃 실험을 수행하는 것은 어렵다. 최근, 우리 그룹은 아마스티고테가 아마스티고테와 같은 특성을 잃지 않고 최대 10 일 동안 축으로 복제 할 수있는 성장 상태를보고했습니다. 이 시간적인 축 식 amastigote 문화를 사용하여, 우리는 성공적으로 유전자 녹아웃을 일으키는 원인이 되기 위하여 Cas9 표현 amastigote에 직접 gRNA를 소개하고 amastigote 단계에서 독점적으로 그들의 표현형을 분석했습니다. 이 보고서에서, 우리는 시험관 내에서 파생 된 세포 외 amastigotes를 생산 하는 상세한 프로토콜을 설명 하 고 CRISPR/Cas9 중재 녹아웃 실험에서 축 배양 활용. 녹아웃 amastigotes의 성장 표현형은 축세포 배양의 세포 수에 의해, 또는 숙주 세포 침략 후에 세포 내 amastigote의 복제에 의해 평가될 수 있습니다. 이 방법은 일반적으로 형질 전환 또는 녹아웃 amastigote생산에 관여하는 기생충 단계 분화를 우회합니다. 시간적 축아제아스티고트 문화의 활용은 T. cruzi에서 단계별 연구의 실험적 자유를 확장할 가능성이 있다.
Introduction
Trypanosoma cruzi는 라틴 아메리카1에서주로 널리 퍼진 Chagas’질병의 원인 에이전트입니다. T. cruzi는 곤충 벡터와 포유류 호스트2사이를 이동하는 독특한 라이프 사이클 단계를 가지고 있습니다. T. cruzi 혈액 을 빠는 triatomine 버그의 midgut에 epimastigote로 복제 하 고 인간 또는 동물 호스트에 증착 되기 전에 그것의 뒷글에 감염 성 메타 세포 trypomastigote로 분화. trypomastigote 물린 사이트를 통해 또는 점 막을 통해 호스트 몸으로 되 면, 기생충 호스트 세포를 침공 하 고 amastigote 라는 편모 없는 둥근 형태로 변환. amastigote는 호스트 세포 내의 복제하고 결국 trypomastigote로 분화합니다, 이는 호스트 세포에서 파열하고 다른 호스트 세포를 감염시키기 위하여 혈류를 입력합니다.
현재 이용 가능한 화학치료제, 벤즈니다졸 및 니푸르티목스는 부작용을 일으키고 질병의 만성 단계에서효과가 없기 때문에 3, T. cruzi에 대한 새로운 약물 표적을 식별하는 것이 큰 관심사이다. 최근 몇 년 동안, CRISPR/Cas9 시스템은 GRNA 및 Cas9 4를 포함하는 별도의 또는 단일 플라스미드(들)의 형질전환에의해, Cas9의 안정적인 발현에 의해 T. cruzi에서유전자 녹아웃을 효과적으로 수행할 수 있는 강력한 도구가 되었습니다. gRNA5,6,7 또는 gRNA8의전사 템플릿의 도입, 또는 미리 형성된 gRNA/Cas9 RNP 복합체의 전기화에 의해7,9. 이러한 기술 발전은 Chagas’질병의 약물 표적 연구를 가속화할 것으로 기대됩니다.
약물 개발을 진행하기 위해서는 포유류 숙주에서 기생충의 복제 단계이기 때문에 T. cruzi의amastigote에서 표적 유전자 또는 약물 후보 화합물의 효능의 본질성을 검증하는 것이 중요합니다. 그러나, 이것은 도전적인 작업, 때문에 방해 호스트 세포의 존재에 직접 조작 할 수 없습니다. 리슈마니아에서는 T. cruzi와밀접하게 관련된 원생 동물 기생충, 축아제 배양 방법이 개발되었으며 약물 스크리닝 검거 법제10,11,12, 13. 도끼 아마스티고테와 세포 내 아마스티고테스(14)사이의 화합물에 대한 감수성에 약간의 불일치가 있지만, 축배양을 유지하는 능력은 그럼에도 불구하고 연구할 귀중한 실험 도구를 제공합니다. 리슈마니아15,16의임상적으로 관련된 단계의 기본 생물학 . T. cruzi의경우, 자연적으로 발생하는 세포외 amastigotes의 존재에 관한 문헌 (EA)17 및 EA의 체외 생산17,18,19 거슬러 올라간다 수십 년 전. 또한, EA는 20의 전염성능력을 가지는 것으로 알려져 있으며, 이는 트라이포마스티고테보다 적기는 하지만, 아마스티고테 숙주 침공의 메커니즘은 최근 몇 년 동안 해명되었다(본피엠-멜로 등21). 그러나, Leishmania와는달리, EA는 T. cruzi에있는 실험 적인 공구로 이용되지 않았습니다, EA가 의무적인 세포내 기생충으로 여겨졌기 때문에, 따라서 실용적인에서 “복제 양식”으로 간주되지 않았기 때문에 감각.
최근 우리 그룹은 T. cruzi의 EA를 일시적인 축문화(22)로 활용하자고 제안했다. T. cruzi Tulahuen 균주의 아마스티고트는 37°C에서 LIT 배지에서 숙주 세포의 자유로운 복제를 최대 10일 동안 주요 열화 또는 아마티고테 유사 성질의 손실 없이 복제할 수 있다. 숙주 없는 성장 기간 동안, EA는 기존의 전기천공에 의한 외인성 유전자 발현, 트라이파노시드 화합물을 통한 약물 적정 분석, CRISPR/Cas9 매개 녹아웃에 의한 성장 표현형 모니터링에 성공적으로 활용되었다. 이 보고서에서, 우리는 시험관내에서 유래된 EA를 생산하고 녹아웃 실험에서 축산 아마스티고테를 활용하기 위한 상세한 프로토콜을 설명한다.
Protocol
Representative Results
Discussion
우리는 T. cruzi amastigotes의 축배양이 Cas9 발현 EA로 직접 gRNA를 전기로 전환해서 CRISPR/Cas9 매개 유전자 녹아웃에서 이용될 수 있다는 것을 보여주었습니다. 이와 같이, amastigote 단계에서 특히 표적 유전자의 본질성은 다른 발달 단계를 거치지 않고 평가될 수 있다.
amastigote 형질감염의 또 다른 유익한 양상은 많은 표적 유전자를 위한 시험에 있는 편의성입니다. 일단 Cas9 발?…
Divulgazioni
The authors have nothing to disclose.
Acknowledgements
이 작품은 Y.T에 JSPS KAKENHI 교부금 번호 18K15141에 의해 부분적으로 지원되었다.
Materials
| 20% formalin solution | FUJIFILM Wako Pure Chemical | 068-03863 | fixing cells |
| 25 cm2 double seal cap culture flask | AGC Techno Glass | 3100-025 | |
| 75 cm2 double seal cap culture flask | AGC Techno Glass | 3110-075 | |
| All-in One Fluorescence Microscope | Keyence | BZ-X710 | |
| Alt-R CRISPR-Cas9 crRNA (for Control) | IDT | custom made | target sequence = GGACGGCACCTTCATCTACAAGG |
| Alt-R CRISPR-Cas9 crRNA (for TcCGM1) | IDT | custom made | target sequence = TAGCCGCGATGGAGAGTTTATGG |
| Alt-R CRISPR-Cas9 crRNA (for TcPAR1) | IDT | custom made | target sequence = CGTGGAGAACGCCATTGCCACGG |
| Alt-R CRISPR-Cas9 tracrRNA | IDT | 1072532 | to anneal with crRNA |
| Amaxa Nucleofector device | LONZA | AAN-1001 | electroporation |
| Basic Parasite Nucleofector Kit 2 | LONZA | VMI-1021 | electroporation |
| BSA | Sigma-Aldrich | A3294 | component of the medium for in-vitro amastigogenesis |
| Burker-Turk disposable hemocytometer | Watson | 177-212C | cell counting |
| Coster 12-well Clear TC-Treated Multiple Well Plates | Corning | 3513 | |
| DMEM | FUJIFILM Wako Pure Chemical | 044-29765 | culture medium |
| Fetal bovine serum, Defined | Hyclone | SH30070.03 | heat-inactivate before use |
| G-418 Sulfate Solution | FUJIFILM Wako Pure Chemical | 077-06433 | selection of transformant |
| Hemin chloride | Sigma-Aldrich | H-5533 | component of LIT medium |
| Hoechst 33342 | Thermo Fisher Scientific | H3570 | staining of nuclei |
| Liver infusion broth, Difco | Becton Dickinson | 226920 | component of LIT medium |
| MES | FUJIFILM Wako Pure Chemical | 349-01623 | component of the medium for in-vitro amastigogenesis |
| PBS (–) | FUJIFILM Wako Pure Chemical | 166-23555 | |
| Propidium Iodide | Sigma-Aldrich | P4864-10ML | staining of dead cells |
| RPMI 1646 | Sigma-Aldrich | R8758 | medium for metacyclogenesis |
Riferimenti
- World Health Organization. . (WHO) Fact sheet: Chagas disease (American trypanosomiasis). , (2017).
- Clayton, J. Chagas disease 101. Nature. 465 (n7301_supp), S4-S5 (2010).
- Apt, W. Current and developing therapeutic agents in the treatment of Chagas disease. Drug Design, Development and Therapy. 4, 243-253 (2010).
- Lander, N., Li, Z. H. H., Niyogi, S., Docampo, R. CRISPR/Cas9-induced disruption of paraflagellar rod protein 1 and 2 genes in Trypanosoma cruzi reveals their role in flagellar attachment. mBio. 6 (4), e01012 (2015).
- Peng, D., Kurup, S. P., Yao, P. Y., Minning, T. A., Tarleton, R. L. CRISPR-Cas9-mediated single-gene and gene family disruption in Trypanosoma cruzi. mBio. 6 (1), e02097-e02114 (2015).
- Romagnoli, B. A. A., Picchi, G. F. A., Hiraiwa, P. M., Borges, B. S., Alves, L. R., Goldenberg, S. Improvements in the CRISPR/Cas9 system for high efficiency gene disruption in Trypanosoma cruzi. Acta Tropica. 178, 190-195 (2018).
- Burle-Caldas, G. A., Soares-Simões, M., Lemos-Pechnicki, L., DaRocha, W. D., Teixeira, S. M. R. Assessment of two CRISPR-Cas9 genome editing protocols for rapid generation of Trypanosoma cruzi gene knockout mutants. International Journal for Parasitology. 48 (8), 591-596 (2018).
- Costa, F. C. Expanding the toolbox for Trypanosoma cruzi: A parasite line incorporating a bioluminescence-fluorescence dual reporter and streamlined CRISPR/Cas9 functionality for rapid in vivo localisation and phenotyping. PLoS Neglected Tropical Diseases. 12 (4), e0006388 (2018).
- Soares Medeiros, L. C. High-Efficiency Genome Editing in Protozoan Parasites Using CRISPR-Cas9 Ribonucleoproteins. mBio. 8 (6), (2017).
- Callahan, H. L., Portal, A. C., Devereaux, R., Grogl, M. An axenic amastigote system for drug screening. Antimicrobial Agents and Chemotherapy. 41 (4), 818-822 (1997).
- Bates, P. A. Axenic culture of Leishmania amastigotes. Parasitology Today. 9 (4), 143-146 (1993).
- Ravinder, R., Bhaskar, B., Gangwar, S., Goyal, N. Development of luciferase expressing Leishmania donovani axenic amastigotes as primary model for in vitro screening of antileishmanial compounds. Current Microbiology. 65 (6), 696-700 (2012).
- Nühs, A. Development and Validation of a Novel Leishmania donovani Screening Cascade for High-Throughput Screening Using a Novel Axenic Assay with High Predictivity of Leishmanicidal Intracellular Activity. PLoS Neglected Tropical Diseases. 9 (9), 1-17 (2015).
- De Rycker, M. Comparison of a high-throughput high-content intracellular Leishmania donovani assay with an axenic amastigote assay. Antimicrobial Agents and Chemotherapy. 57 (7), 2913-2922 (2013).
- Rochette, A., Raymond, F., Corbeil, J., Ouellette, M., Papadopoulou, B. Whole-genome comparative RNA expression profiling of axenic and intracellular amastigote forms of Leishmania infantum. Molecular and Biochemical Parasitology. 165 (1), 32-47 (2009).
- Pescher, P., Blisnick, T., Bastin, P., Späth, G. F. Quantitative proteome profiling informs on phenotypic traits that adapt Leishmania donovani for axenic and intracellular proliferation. Cellular Microbiology. 13 (7), 978-991 (2011).
- Andrews, N. W., Hong, K. S. U., Robbins, E. S., Nussenzweig, V. Stage-specific surface antigens expressed during the morphogenesis of vertebrate forms of Trypanosoma cruzi. Experimental Parasitology. 64 (3), 474-484 (1987).
- Pan, S. C. Trypanosoma cruzi: intracellular stages grown in a cell-free medium at 37 C. Experimental Parasitology. 45 (2), 215-224 (1978).
- Tomlinson, S., Vandekerckhove, F., Frevert, U., Nussenzweig, V. The induction of Trypanosoma cruzi trypomastigote to amastigote transformation by low pH. Parasitology. 110 (05), 547 (1995).
- Ley, V., Andrews, N. W., Robbins, E. S., Nussenzweig, V. Amastigotes of Trypanosoma cruzi sustain an infective cycle in mammalian cells. Journal of Experimental Medicine. 168 (0022-1007 (Print)), 649-659 (1988).
- Bonfim-Melo, A., Ferreira, E. R., Florentino, P. T. V., Mortara, R. A. Amastigote Synapse: The Tricks of Trypanosoma cruzi Extracellular Amastigotes. Frontiers in Microbiology. 9, 1341 (2018).
- Takagi, Y., Akutsu, Y., Doi, M., Furukawa, K. Utilization of proliferable extracellular amastigotes for transient gene expression, drug sensitivity assay, and CRISPR/Cas9-mediated gene knockout in Trypanosoma cruzi. PLOS Neglected Tropical Diseases. 13 (1), e0007088 (2019).
- Fernandes, J. F., Castellani, O. Growth characteristics and chemical composition of Trypanosoma cruzi. Experimental Parasitology. 18 (2), 195-202 (1966).
- Oberholzer, M., Lopez, M. A., Ralston, K. S., Hill, K. L. Approaches for Functional Analysis of Flagellar Proteins in African Trypanosomes. Methods in Cell Biology. 93, 21-57 (2009).
- van den Hoff, M. J. B., Moorman, A. F. M., Lamers, W. H. Electroporation in ‘intracellular’ buffer increases cell survival. Nucleic Acids Research. 20 (11), 2902-2902 (1992).
- Pacheco-Lugo, L., Díaz-Olmos, Y., Sáenz-García, J., Probst, C. M., DaRocha, W. D. Effective gene delivery to Trypanosoma cruzi epimastigotes through nucleofection. Parasitology International. 66 (3), 236-239 (2017).
- Coughlin, B. C., Teixeira, S. M., Kirchhoff, L. V., Donelson, J. E. Amastin mRNA abundance in Trypanosoma cruzi is controlled by a 3’-untranslated region position-dependent cis-element and an untranslated region-binding protein. The Journal of Biological Chemistry. 275 (16), 12051-1260 (2000).
- Shaw, A. K., Kalem, M. C., Zimmer, S. L. Mitochondrial Gene Expression Is Responsive to Starvation Stress and Developmental Transition in Trypanosoma cruzi. mSphere. 1 (2), (2016).
- Chao, D., Dusanic, D. G. Comparative studies of the isolation of metacyclic trypomastigotes of Trypanosoma cruzi by DEAE ion exchange chromatography. Zhonghua Minguo wei sheng wu ji mian yi xue za zhi (Chinese Journal of Microbiology and Immunology). 17 (3), 146-152 (1984).
- Nogueira, N., Bianco, C., Cohn, Z. Studies on the selective lysis and purification of Trypanosoma cruzi. The Journal of Experimental Medicine. 142 (1), 224-229 (1975).
- Minning, T. A., Weatherly, D. B., Atwood, J., Orlando, R., Tarleton, R. L., Tarleton, R. L. The steady-state transcriptome of the four major life-cycle stages of Trypanosoma cruzi. BMC Genomics. 10, 370 (2009).
- Rico, E., Jeacock, L., Kovářová, J., Horn, D. Inducible high-efficiency CRISPR-Cas9-targeted gene editing and precision base editing in African trypanosomes. Scientific Reports. 8 (1), 7960 (2018).
- Fu, Y. High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nature Biotechnology. 31 (9), 822-826 (2013).
- Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Research. 24 (6), 1012-1019 (2014).
- Chiurillo, M. A., Lander, N., Bertolini, M. S., Storey, M., Vercesi, A. E., Docampo, R. Different roles of mitochondrial calcium uniporter complex subunits in growth and infectivity of Trypanosoma cruzi. mBio. 8 (3), e00574-e00617 (2017).
