JoVE Journal > Genetics
Summary
Abstract
Introduction
Protocol
Risultati
Discussion
Divulgazioni
Acknowledgements
Materials
Riferimenti
Traduzione automatica
Please note that all translations are automatically generated. Click here for the English version.
Genetica

깨지기 쉬운 X 정신 지체-1 유전자에서 시토신 구아닌-구아닌 트리뉴클레오티드 반복을 정량화하기 위한 견고한 폴리머라제 연쇄 반응 기반 분석

Published: September 16, 2019
doi:
10.3791/59963
, , , , , , , , , ,
1Central Laboratory, Bao’an Maternity and Child Health Hospital,Jinan University, 2Department of Obstetrics and Gynaecology,The Chinese University of Hong Kong, 3Shenzhen Research Institute,The Chinese University of Hong Kong, 4Department of Genetics and Metabolism,Maternal and Child Health Hospital of Guangxi Zhuang Autonomous Region, 5PerkinElmer Diagnostics, 6Department of Obstetrics and Gynecology, Bao’an Maternity and Child Health Hospital,Jinan University, 7Maternal-Fetal Medicine Institute, Bao’an Maternity and Child Health Hospital,Jinan University

Summary

연약한 X 정신 지체-1 유전자에서 시토신 구아닌-구아닌 트리뉴클레오티드 반복을 정량화하기 위한 정확하고 견고한 중합효소 연쇄 반응 기반 분석은 깨지기 쉬운 X 증후군 및 연약한 X 증후군및 연약한 X 관련의 분자 진단 및 스크리닝을 용이하게 합니다. 턴라운드 시간이 짧고 장비에 대한 투자가 부족합니다.

Abstract

깨지기 쉬운 X 증후군(FXS) 및 관련 장애는 연약한 X 정신지체-1(FMR1)유전자 프로모터의 5′ 번역되지 않은 영역(UTR)에서 시토신 구아닌(CGG) 삼뉴클레오티드 반복의 확장에 의해 유발된다. 종래에는 유전분석기의 모세관 전기동공단편 분석이 FMR1의CGG 반복의 크기 조정에 사용되지만, 반복 횟수가 200개 이상일 때 정확한 측정을 위해 추가적인 남부 얼룩 분석이 요구된다. 여기서, 우리는 FMR1의CGG 반복의 정량화를 위한 정확하고 견고한 중합효소 연쇄 반응(PCR) 기반 방법을 제시한다. 이 시험의 첫 번째 단계는 깨지기 쉬운 X PCR 키트를 사용하여 FMR1 프로모터의 5’UTR에서 반복 서열을 증폭한 다음, PCR 제품의 정제 및 미세 유체 모세관 전기 동공 계측기의 단편 크기 조정, 및 분석 소프트웨어를 사용하여 알려진 반복으로 표준을 참조하여 CGG 반복 횟수를 후속 해석합니다. 이러한 PCR 기반 분석법들은 재현가능하고 200개 이상의 반복 횟수(전체 돌연변이로 분류됨), 55~200(전분), 46~54(중간), 및 10을 포함하는 FMR1 프로모터의 전체 범위의 CGG 반복을 식별할 수 있다. 45 (정상). 그것은 견고성과 빠른보고 시간으로 FXS 및 깨지기 쉬운 X 관련 장애의 분류를 용이하게하는 비용 효율적인 방법입니다.

Introduction

깨지기 쉬운 X 증후군 (FXS) 및 깨지기 쉬운 X 관련 무질서, 예를 들면, 전율 및 운동 실조 증후군 (FX-TAS), 및 1 차적인 난소 불충분 (FX-POI)는 주로 5’번역되지 않은 에 있는 cytosine 구아닌 구아닌 (CGG) trinucleotide 반복 확장에 기인합니다 Xq27.31,2에깨지기 쉬운 X 정신 지체-1(FMR1)유전자의 영역 (UTR) FMR1 인코딩 단백질 (FMRP)은 mRNA의 대체 접합, 안정성 및 수지상 수송을 조절하여 신경 발달 및 시냅스 가소성에서 작동하는 폴리리보솜 관련 RNA 결합 단백질 또는 변조 합성입니다. 부분 적인 후두 단백질의 3,4 ,5,6,7.

>200의 CGG 반복 크기를 가진 동적 변이는 전체 돌연변이로 설명되며, 이는 FMR1 프로모터8의비정상적인 하이퍼메틸화 및 후속 전사 침묵을 유도한다. FMRP 단백질의 부재 또는 부족은 정상적인 신경 발달을 방해하고 FXS9를일으키며, 중등도에서 중증의 지적 장애, 발달 지연, 비활동성 행동, 가난한 접촉과 자폐증 표현10,11,12. 여성 FXS 환자에 있는 프리젠테이션은 일반적으로 남성에서 보다는 온화합니다. CGG 반복 크기는 각각 55에서 200 및 45~54에 이르는 선열 상태와 중간 상태로 분류됩니다. 높은 수준의 불안정성으로 인해, CGG 반복 크기는 부모로부터 자손13,14로전염될 때 아마도 확장될 것이다. 따라서, 전열 대말기를 가진 운반대는 반복 적인 팽창 때문에 FXS에 영향을 받은 아이들이 있는 의 고위험에 이고, 어떤 경우에는, 중간 대두는 2 세대15에걸쳐 전체 돌연변이 범위로 그들의 반복 크기를 확장할 수 있습니다15, 16. 또한, 전열을 가진 남성은 또한 FX-TAS와 FX-POI20둘 다에 걸리기 위하여 전열 암컷이 걸리기 동안, 늦은 개시 FX-TAS17,18,19,개발의 증가한 리스크를전달합니다, 21,22. 최근에는 발달 지연과 사회 행동의 문제가 있는 자폐 스펙트럼 장애가 FMR1 대립유전자전형인 어린이(23,24)에서제시되는 것으로 보고되고 있다.

정확한 CGG 반복 크기를 결정하는 것은 FXS 및 깨지기 쉬운 X-관련장애(25,26)의분류 및 예측에 큰 의미가 있다. 역사적으로, 단편 크기 조정을 더한 CGG 반복 영역 별 중합효소 연쇄 반응(PCR)은 FMR1 CGG 반복27의분자 프로파일링을 위한 금 본위제였다. 그러나, 전통적인 특이적 PCR은 100 개 이상의 130 회 이상의 반복을 가진 큰 전열에 덜 민감하고 전체 돌연변이27,28을증폭시킬 수 없다. 또한, 반복 크기 조정을 위한 전통적인 유전자 분석기의 모세관 전기 동공은 200CGG 이상의 반복으로 FMR1 PCR 제품을 검출하지 못합니다. 남부 얼룩 분석은 정상에서 전체 돌연변이 반복 수에 이르기까지 더 넓은 범위의 반복 크기를 분화할 수 있게 해주며, 전체 돌연변이(남성에서) 전체 돌연변이를 확인하고 전체 돌연변이를 가진 헤테로지구스 알레를 분화하는 데 널리 사용되어 왔습니다. 분명히 동형 접합 대말레는 정상 크기의 (여성에서). 그러나 반복을 정량화하기 위한 해상도는 제한적입니다. 더 중요한 것은 이 단계별 테스트 전략은 노동 집약적이고 시간이 많이 소요되며 비용이 비효율적이라는 것입니다.

여기서는 FMR1의CGG 반복을 정량화하기 위한 정확하고 견고한 PCR 기반 방법을 제시합니다. 이 시험의 첫 번째 단계는 깨지기 쉬운 X PCR 키트를 사용하여 FMR1 프로모터의 5’UTR에서 반복 서열의 PCR 증폭이다. PCR 제품은 정제되고 단편 크기 조정은 미세 유체 모세관 전기 동공 계측기에서 수행되며, 후속 해석 소프트웨어를 사용하여 CGG 반복 횟수를 해석하여 공지된 반복으로 표준을 참조하여 PCR 조각 길이가 CGG 반복 횟수에 정비례한다는 근거입니다. PCR 시스템은 고도로 풍부한 삼뉴클레오티드 반복 영역의 증폭을 용이하게 하는 시약을 포함한다. 이러한 PCR 기반 분석은 재현가능하고 FMR1 프로모터의 모든 CGG 반복을 식별할 수 있다. 이것은 FXS 및 깨지기 쉬운 X 관련 장애의 분자 진단 및 스크리닝에서 광범위한 응용 을 찾을 수있는 비용 효율적인 방법이며, 따라서 장비에 대한 턴어라운드 시간과 투자가 적어 광범위한 임상 스펙트럼에서 활용 될 수 있습니다. 실험실.

Protocol

홍콩 공동 중국대학-신계 동쪽 클러스터 임상 연구 윤리위원회(참조 번호: 2013.055) 1. PCR 증폭 시작하기 전에 PCR 완충제 혼합물, 시료 희석제 및 DNA 샘플(검사 및 참조 DNA 모두)을-20°C 냉동고에서 제거하고 모든 시약과 DNA가 완전히 해동되었는지 확인하기 위해 실온에서 20-30분 동안 보관하십시오. 소용돌이와 사용하기 전에 잠시 아래로 돌루. 분광광?…

Representative Results

상기 전돌연변이 암 기준 샘플(NA20240, 30 및 80의 반복 크기)과 전체 돌연변이 암 기준 샘플(NA20239, 20 및 200의 반복 크기)의 크기 조정 결과는 각각 도 1A 및 도 1B에나타내고 있다. 전형적으로, 2개의 마커 피크(하부 마커 50 염기 쌍 [bp] 및 상부 마커 10,380 bp)는 단편 크기 프로파일에 포함된다. 일반적으로 거의 95 bp의 크기와 프라이머 복잡한 피크가있다. 참?…

Discussion

FXS는 삼중 21 후 지적 장애의 두 번째 가장 흔한 원인이며, X 연결 정신 지체30의거의 절반을 차지하며, 이는 4,000명의 남성중 약 1명, 8,000명의 여성 중 1명에 영향을 미칠 수 있습니다. 더 중요한 것은, 250-1,000명의 암컷에 있는 거의 1은 premutation를 전송하고, 이 주파수는 남성26,31,32,33에서</s…

Divulgazioni

The authors have nothing to disclose.

Acknowledgements

이 연구는 NSFC 비상 관리 프로젝트 (그랜트 번호 81741004), 중국의 국립 자연 과학 재단 (그랜트 번호 81860272), 광시 지방 과학 기술 재단의 주요 연구 계획 ( 그랜트 번호 AB16380219), 중국 박사 후 과학 재단 보조금 (그랜트 번호 2018M630993), 광시 자연 과학 재단 (그랜트 번호 2018GXNSFAA281067).

Materials

Agilent 2100 Bioanalyzer instrument: 0.2 mL PCR tubes Axygen PCR-02D-C
Agilent 2100 Bioanalyzer instrument: 1X TE buffer, pH 8.0, Rnase-free Ambion AM9849
Agilent 2100 Bioanalyzer instrument: 2100 Bioanalyzer instrument Agilent G2939AA
Agilent 2100 Bioanalyzer instrument: 96-well PCR Plate Thermo Fisher AB0800
Agilent 2100 Bioanalyzer instrument: Electrode cartridge Agilent Supplies equipment of the 2100 Bioanayzer instrument
Agilent 2100 Bioanalyzer instrument: IKA vortex mixer Agilent Supplies equipment of the 2100 Bioanayzer instrument
Agilent 2100 Bioanalyzer instrument: Sizing software 2100 Expert software Agilent Supplies equipment of the 2100 Bioanayzer instrument
Agilent 2100 Bioanalyzer instrument: Test chips Agilent Supplies equipment of the 2100 Bioanayzer instrument
Agilent DNA 7500 kit Agilent 5067-1506 For Fragment sizing
Agilent DNA 7500 kit: DNA 7500 Ladder (yellow cap) Agilent In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: DNA 7500 Markers (green cap) Agilent In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: DNA chips Agilent In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: DNA Dye Concentrate (blue cap) Agilent In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: DNA Gel Matrix Vial (red cap) Agilent In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: Electrode Cleaner Agilent In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: Spin Filter Agilent Supplies of Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: Syringe Agilent Supplies of Agilent DNA 7500 kit (catalog number: 5067-1506)
Chip priming station Agilent 5065-4401 Supplies equipment of the 2100 Bioanayzer instrument
Cubee Mini-centrifuge GeneReach aqbd-i
Filter plate vacuum Manifold: MultiScreenHTS Vacuum Manifold Merck Millipore MSVMHTS00 Vacuum instrument for Filter plate vacuum Manifold for PCR product purification
Filter plate vacuum Manifold: Silicone stopper Merck Millipore XX2004718 Filter plate vacuum Manifold
Filter plate vacuum Manifold: Vacuum pump Merck Millipore WP6122050 Filter plate vacuum Manifold
Filter plate vacuum Manifold: Waste collection vessel Merck Millipore XX1004705 Filter plate vacuum Manifold
FragilEase Fragile X PCR kit PerkinElmer 3101-0010 For PCR amplification
FragilEase Fragile X PCR kit: Sample Diluent PerkinElmer In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 )
FragilEase PCR Buffer mix PerkinElmer In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 ), containing primers. Primer sequences: TCAGGCGCTCAGCTCCGTTTCGGTTTCA (forward)
FAM-AAGCGCCATTGGAGCCCCGCACTTCC (reverse)
FragilEase Polymerase PerkinElmer In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 )
FraXsoft analysis software PerkinElmer
NanoDrop ND-2000 Spectrophotometer Thermo Fisher
Paper towels
PCR clean up plate: NucleoFast 96 PCR plate MACHEREY-NAGEL 743100
reference DNA sample Coriell NA20240 & NA20239
S1000 96-well Thermal Cycler Bio-Rad 1852196 This can be replaced by other Thermal Cyclers (eg. Veriti™ 96-Well Thermal Cycler, Applied Biosystems, catalog number: 4375786)
TriNEST Incubator/Shaker instrument PerkinElmer 1296-0050
UltraPure DNase/RNase-Free Distilled Water Life Technologies 10977015 For 2100 Bioanalyzer electrode cleaning
Vortex-Genie 2 Scientific Industries SI-0256 (Model G560E) Conventional vortex mixer
DOWNLOAD MATERIALS LIST

Riferimenti

  1. Verkerk, A. J., et al. Identification of a gene (FMR-1) containing a CGG repeat coincident with a breakpoint cluster region exhibiting length variation in fragile X syndrome. Cell. 65, 905-914 (1991).
  2. Fu, Y. H., et al. Variation of the CGG repeat at the fragile X site results in genetic instability: resolution of the Sherman paradox. Cell. 67, 1047-1058 (1991).
  3. Antar, L. N., Li, C., Zhang, H., Carroll, R. C., Bassell, G. J. Local functions for FMRP in axon growth cone motility and activity-dependent regulation of filopodia and spine synapses. Molecular and Cellular Neurosciences. 32, 37-48 (2006).
  4. Didiot, M. C., et al. The G-quartet containing FMRP binding site in FMR1 mRNA is a potent exonic splicing enhancer. Nucleic Acids Research. 36, 4902-4912 (2008).
  5. Bechara, E. G., et al. A novel function for fragile X mental retardation protein in translational activation. PLoS Biology. 7, e16 (2009).
  6. Ascano, M., et al. FMRP targets distinct mRNA sequence elements to regulate protein expression. Nature. 492, 382-386 (2012).
  7. Kenny, P. J., et al. MOV10 and FMRP regulate AGO2 association with microRNA recognition elements. Cell Reports. 9, 1729-1741 (2014).
  8. Oberle, I., et al. Instability of a 550-base pair DNA segment and abnormal methylation in fragile X syndrome. Science. 252, 1097-1102 (1991).
  9. Hagerman, R., Lauterborn, J., Au, J., Berry-Kravis, E. Fragile X syndrome and targeted treatment trials. Results and Problems in Cell Differentiation. 54, 297-335 (2012).
  10. Hatton, D. D., et al. Autistic behavior in children with fragile X syndrome: prevalence, stability, and the impact of FMRP. American Journal of Medical Genetics Part A. 140A, 1804-1813 (2006).
  11. Mattei, J. F., Mattei, M. G., Aumeras, C., Auger, M., Giraud, F. X-linked mental retardation with the fragile X. A study of 15 families. Human Genetics. 59, 281-289 (1981).
  12. Backes, M., et al. Cognitive and behavioral profile of fragile X boys: correlations to molecular data. American Journal of Medical Genetics. 95, 150-156 (2000).
  13. Nolin, S. L., et al. Fragile X analysis of 1112 prenatal samples from 1991 to 2010. Prenatal Diagnosis. 31, 925-931 (2011).
  14. Nolin, S. L., et al. Expansion of the fragile X CGG repeat in females with premutation or intermediate alleles. American Journal of Human Genetics. 72, 454-464 (2003).
  15. Fernandez-Carvajal, I., et al. Expansion of an FMR1 grey-zone allele to a full mutation in two generations. Journal of Molecular Diagnostics. 11, 306-310 (2009).
  16. Terracciano, A., et al. Expansion to full mutation of a FMR1 intermediate allele over two generations. European Journal of Human Genetics. 12, 333-336 (2004).
  17. Garcia-Arocena, D., Hagerman, P. J. Advances in understanding the molecular basis of FXTAS. Human Molecular Genetics. 19, R83-R89 (2010).
  18. Juncos, J. L., et al. New clinical findings in the fragile X-associated tremor ataxia syndrome (FXTAS). Neurogenetics. 12, 123-135 (2011).
  19. Hagerman, R. J., et al. Intention tremor, parkinsonism, and generalized brain atrophy in male carriers of fragile X. Neurology. 57, 127-130 (2001).
  20. Conway, G. S. Premature ovarian failure and FMR1 gene mutations: an update. Annales d’endocrinologie. 71, 215-217 (2010).
  21. Conway, G. S., Hettiarachchi, S., Murray, A., Jacobs, P. A. Fragile X premutations in familial premature ovarian failure. Lancet. 346, 309-310 (1995).
  22. Van Esch, H., Buekenhout, L., Race, V., Matthijs, G. Very early premature ovarian failure in two sisters compound heterozygous for the FMR1 premutation. European Journal of Medical Genetics. 52, 37-40 (2009).
  23. Bourgeois, J. A., et al. A review of fragile X premutation disorders: expanding the psychiatric perspective. Journal of Clinical Psychiatry. 70, 852-862 (2009).
  24. Farzin, F., et al. Autism spectrum disorders and attention-deficit/hyperactivity disorder in boys with the fragile X premutation. Journal of Developmental and Behavioral Pediatrics. 27, S137-S144 (2006).
  25. Hantash, F. M., et al. FMR1 premutation carrier frequency in patients undergoing routine population-based carrier screening: insights into the prevalence of fragile X syndrome, fragile X-associated tremor/ataxia syndrome, and fragile X-associated primary ovarian insufficiency in the United States. Genetics in Medicine. 13, 39-45 (2011).
  26. Kraan, C. M., et al. FMR1 allele size distribution in 35,000 males and females: a comparison of developmental delay and general population cohorts. Genetics in Medicine. 20 (12), 1627-1634 (2018).
  27. Saul, R. A., Tarleton, J. C. FMR1-Related Disorders. GeneReviews. , (2012).
  28. Amos Wilson, J., et al. Consensus characterization of 16 FMR1 reference materials: a consortium study. Journal of Molecular Diagnostics. 10, 2-12 (2008).
  29. Kwok, Y. K., et al. Validation of a robust PCR-based assay for quantifying fragile X CGG repeats. Clinica Chimica Acta. 456, 137-143 (2016).
  30. Rousseau, F., Rouillard, P., Morel, M. L., Khandjian, E. W., Morgan, K. Prevalence of carriers of premutation-size alleles of the FMRI gene–and implications for the population genetics of the fragile X syndrome. American Journal of Human Genetics. 57, 1006-1018 (1995).
  31. Tassone, F., et al. FMR1 CGG allele size and prevalence ascertained through newborn screening in the United States. Genome Medicine. 4, 100 (2012).
  32. Dombrowski, C., et al. Premutation and intermediate-size FMR1 alleles in 10572 males from the general population: loss of an AGG interruption is a late event in the generation of fragile X syndrome alleles. Human Molecular Genetics. 11, 371-378 (2002).
  33. Cronister, A., Teicher, J., Rohlfs, E. M., Donnenfeld, A., Hallam, S. Prevalence and instability of fragile X alleles: implications for offering fragile X prenatal diagnosis. Obstetrics and Gynecology. 111, 596-601 (2008).
  34. Hayward, B. E., Kumari, D., Usdin, K. Recent advances in assays for the fragile X-related disorders. Human Genetics. 136, 1313-1327 (2017).
  35. Seltzer, M. M., et al. Prevalence of CGG expansions of the FMR1 gene in a US population-based sample. American Journal of Medical Genetics Part B Neuropsychiatrics Genetics. 259B, 589-597 (2012).
  36. Hayward, B. E., Usdin, K. Assays for determining repeat number, methylation status, and AGG interruptions in the Fragile X-related disorders. Methods in Molecular Biology. , 49-59 (1942).
  37. Orrico, A., et al. Mosaicism for full mutation and normal-sized allele of the FMR1 gene: a new case. American Journal of Medical Genetics. 78, 341-344 (1998).
  38. Schmucker, B., Seidel, J. Mosaicism for a full mutation and a normal size allele in two fragile X males. American Journal of Medical Genetics. 84, 221-225 (1999).

Tags

PCR AssayFragile X Mental Retardation-1 GeneCGG Trinucleotide RepeatsMolecular DiagnosisFragile X SyndromeFragile X-related DisordersCost-effectiveRapid ReportingDNA Sample PreparationPCR Master MixPCR Cleanup
check_url/it/59963?article_type=t

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Citazione di questo articolo
Wang, H., Zhu, X., Gui, B., Cheung, W. C., Shi, M., Yang, Z., Kwok, K. Y., Lim, R., Pietilä, S., Zhu, Y., Choy, K. W. A Robust Polymerase Chain Reaction-based Assay for Quantifying Cytosine-guanine-guanine Trinucleotide Repeats in Fragile X Mental Retardation-1 Gene. J. Vis. Exp. (151), e59963, doi:10.3791/59963 (2019).
Scarica citazione
Ristampe e autorizzazioni

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image