JoVE Journal > Genetics
Summary
Abstract
Introduction
Protocol
Risultati
Discussion
Divulgazioni
Acknowledgements
Materials
Riferimenti
Traduzione automatica
Genetica

Um ensaio robusto baseado em reação em cadeia da polimerase para quantificar repetições de trinucleotídeo de citosina-guanina-guanina em X frágil retardo mental-1 gene

Published: September 16, 2019
doi:
10.3791/59963
, , , , , , , , , ,
1Central Laboratory, Bao’an Maternity and Child Health Hospital,Jinan University, 2Department of Obstetrics and Gynaecology,The Chinese University of Hong Kong, 3Shenzhen Research Institute,The Chinese University of Hong Kong, 4Department of Genetics and Metabolism,Maternal and Child Health Hospital of Guangxi Zhuang Autonomous Region, 5PerkinElmer Diagnostics, 6Department of Obstetrics and Gynecology, Bao’an Maternity and Child Health Hospital,Jinan University, 7Maternal-Fetal Medicine Institute, Bao’an Maternity and Child Health Hospital,Jinan University

Summary

Um ensaio exato e robusto da reacção em cadeia do polymerase para quantificar repetições do trinucleotide da citosina-guanina-guanina no frágil X retardo mental-1 gene facilita o diagnóstico molecular e a seleção da síndrome frágil de X e do X-relacionado frágil distúrbios com tempo de virada mais curto e investimento em equipamentos.

Abstract

A síndrome de X frágil (FXS) e as desordens associadas são causadas pela expansão da repetição do trinucleotide da citosina-guanina-guanina (CGG) na região 5 ‘ Untranslated (UTR) do promotor do gene do retardo mental X-1 (FMR1) frágil. Convencionalmente, a análise capilar do fragmento da electroforese em um analisador genético é usada para o dimensionamento das repetições de CGG de FMR1, mas a análise adicional do Sul do Borrão é exigida para a medida exata quando o número da repetição é mais elevado do que 200. Aqui, nós apresentamos um método exato e robusto da reacção em cadeia do polymerase (PCR)-baseado para a quantificação das repetições de CGG de FMR1. A primeira etapa deste teste é a amplificação do PCR das seqüências da repetição no 5 ‘ UTR do promotor FMR1 usando um jogo frágil do PCR de X, seguido pela purificação dos produtos do PCR e do fragmento que cola em um instrumento capilar microfluídicos da electroforese, e interpretação subseqüente do número de repetições CGG referenciando padrões com repetições conhecidas usando o software de análise. Este ensaio PCR-baseado é reprodutível e capaz de identificar a série completa de repetições de CGG de FMR1 promotores, incluindo aqueles com um número da repetição de mais de 200 (classific como a mutação cheia), 55 a 200 (premutação), 46 a 54 (intermediário), e 10 a 45 (normal). É um método rentável que facilita a classificação do FXS e de desordens X-associadas frágeis com robustez e tempo de relatório rápido.

Introduction

A síndrome de X frágil (FXS) e as desordens associadas frágeis de X, por exemplo, a síndrome do tremor e da ataxia (FX-TAS), e a insuficiência ovariana preliminar (FX-POI) são causadas principalmente pela expansão da repetição do trinucleotide da citosina-guanina-guanina (CGG) nos 5 ‘ não traduzidos região (UTR) do gene frágil X retardo mental-1 (FMR1) no xq 27,31,2. A proteína FMR1 codificada (FMRP) é uma proteína de ligação de RNA associada a poliribosome que funciona no desenvolvimento neuronal e na plasticidade sináptica, regulando a emenda alternativa, estabilidade e transporte dendrítico de mRNA ou síntese moduladora de proteínas pós-sinápticas parciais3,4,5,6,7.

A variação dinâmica com um tamanho da repetição de CGG de > 200 é descrita como a mutação cheia, que induz o hipermetilação aberrante e o silenciamento transcricional subseqüente do promotor FMR1 8. A ausência ou falta resultante da proteína FMRP interrompe o desenvolvimento neuronal normal e provoca o FXS9, caracterizado por vários sintomas clínicos, incluindo incapacidade intelectual moderada a grave, atraso no desenvolvimento, comportamentos hiperativos, contatos pobres e manifestações autísticas10,11,12. A apresentação em pacientes fêmeas de FXS é geralmente mais suave do que aquela nos machos. O tamanho da repetição de CGG que varia de 55 a 200 e de 45 a 54 é classific como a pré-mutação e o status intermediário, respectivamente. Devido ao alto grau de instabilidade, o tamanho da repetição de CGG em uma pré-mutação ou alelo intermediário presumivelmente se expande quando transmitido dos pais para a descendência13,14. Assim, os portadores com alelos da pré-mutação estão no risco elevado de ter as crianças afetadas com o FXS por causa da expansão da repetição, e em alguns casos, os alelos intermediários podem expandir seu tamanho da repetição à escala cheia da mutação sobre duas gerações15, a 16. Além disso, os machos com pré-mutação também transmitem um risco aumentado de desenvolvimento de FX-tas de início tardio17,18,19, enquantoasfêmeas depré-mutação são predispostas para FX-tas e FX-POI20, 21,22. Recentemente, tem sido relatado que distúrbios do espectro autístico com atraso no desenvolvimento e problemas em comportamentos sociais são apresentados em crianças com pré-mutação FMR1 alelos23,24.

Para determinar o tamanho exato da repetição de CGG é de grande importância para classificação e predição do FXS e de desordens X-associadas frágeis25,26. Historicamente, a reação em cadeia da polimerase específica da região de repetição CGG (PCR) com dimensionamento de fragmento mais a análise do Southern blot tem sido o padrão-ouro para o perfil molecular da repetição de FMR1 CGG27. Entretanto, o PCR específico tradicional é menos sensível às grandes pré-mutações com mais de 100 a 130 repetições e é incapaz de amplificar mutações cheias27,28. Além disso, a electroforese capilar em um analisador genético tradicional para o dimensionamento da repetição não detecta produtos de FMR1 PCR com mais de 200 repetições de CGG. A análise do Sul do borrão permite a diferenciação de uma escala mais larga do tamanho da repetição, de normal aos números inteiros da repetição da mutação, e foi amplamente utilizada confirmando mutações cheias (nos machos) e diferenciando alelos heterozygous com uma mutação cheia de alelos aparentemente homozygous com tamanhos normais da repetição (nas fêmeas). No entanto, a resolução para quantificar as repetições é limitada. Mais importante, esta estratégia de teste passo a passo é trabalhosa, demorada, e custo-ineficaz.

Aqui, nós apresentamos um método exato e robusto da PCR-baseado para a quantificação das repetições de CGG de FMR1. A primeira etapa deste teste é amplificação do PCR das seqüências da repetição no 5 ‘ UTR do promotor FMR1 usando o jogo frágil do PCR de X. Os produtos do PCR são purified e o dimensionamento do fragmento é executado em um instrumento capilar microfluídicos da electroforese, e na interpretação subseqüente do número de repetições de CGG usando o software da análise referenciando padrões com repetições conhecidas baseadas no racional que o comprimento do fragmento do PCR é diretamente proporcional ao número de repetições de CGG. O sistema do PCR inclui os reagentes que facilitam a amplificação da região altamente GC-rica da repetição do trinucleotide. Este ensaio PCR-baseado é reprodutível e capaz de identificar todas as escalas de repetições de CGG de FMR1 promotores. Este é um método rentável que pode encontrar a aplicação larga no diagnóstico molecular e na seleção do FXS e de desordens X-relacionadas frágeis com menos tempo do turn-around e o investimento no equipamento e assim, pode ser utilizado em um espectro mais largo de clínico Laboratórios.

Protocol

A aprovação ética foi concedida pela Universidade conjunta chinesa de Hong Kong ― Comitê de ética em pesquisa clínica do grupo de novos territórios do leste (número de referência: 2013, 55) 1. amplificação do PCR Antes de começar, remova a mistura do tampão do PCR, amostras do diluente e do ADN da amostra (teste e ADN da referência) (veja a tabela dos materiais) do congelador de-20 ° c e mantenha-os na temperatura ambiente por 20-30 minutos para cert…

Representative Results

Os resultados de dimensionamento da amostra de referência feminina de pré-mutação (NA20240, tamanhos de repetição de 30 e 80) e a amostra de referência feminina de mutação completa (NA20239, tamanhos de repetição de 20 e 200) são mostrados na Figura 1a e na Figura 1b, respectivamente. Normalmente, dois picos de marcador (menor marcador 50 pares de base [BP] e marcador superior 10.380 BP) são incluídos no perfil de tamanho do fragmento. Há geralmen…

Discussion

O FXS é a segunda causa mais comum de comprometimento intelectual após a trisminha 21, representando quase metade do retardo mental ligado ao X30, que pode afetar aproximadamente 1 em 4.000 machos e 1 em 8.000 fêmeas. Mais importante, quase 1 em 250 – 1000 fêmeas carregam uma pré-mutação, e esta freqüência é 1 em 250 – 1600 nos machos26,31,32,33. Desde que …

Divulgazioni

The authors have nothing to disclose.

Acknowledgements

Esta pesquisa foi apoiada por subsídios do projeto de gerenciamento de emergência da NSFC (Grant no. 81741004), a Fundação Nacional de ciências naturais da China (Grant no. 81860272), o principal plano de pesquisa da Fundação provincial de ciência e tecnologia de Guangxi ( Grant no. AB16380219), o Grant da Fundação da ciência de pós-doutorado de China (Grant no. 2018M630993), e a Fundação da ciência natural de Guangxi (Grant no. 2018GXNSFAA281067).

Materials

Agilent 2100 Bioanalyzer instrument: 0.2 mL PCR tubes Axygen PCR-02D-C
Agilent 2100 Bioanalyzer instrument: 1X TE buffer, pH 8.0, Rnase-free Ambion AM9849
Agilent 2100 Bioanalyzer instrument: 2100 Bioanalyzer instrument Agilent G2939AA
Agilent 2100 Bioanalyzer instrument: 96-well PCR Plate Thermo Fisher AB0800
Agilent 2100 Bioanalyzer instrument: Electrode cartridge Agilent Supplies equipment of the 2100 Bioanayzer instrument
Agilent 2100 Bioanalyzer instrument: IKA vortex mixer Agilent Supplies equipment of the 2100 Bioanayzer instrument
Agilent 2100 Bioanalyzer instrument: Sizing software 2100 Expert software Agilent Supplies equipment of the 2100 Bioanayzer instrument
Agilent 2100 Bioanalyzer instrument: Test chips Agilent Supplies equipment of the 2100 Bioanayzer instrument
Agilent DNA 7500 kit Agilent 5067-1506 For Fragment sizing
Agilent DNA 7500 kit: DNA 7500 Ladder (yellow cap) Agilent In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: DNA 7500 Markers (green cap) Agilent In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: DNA chips Agilent In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: DNA Dye Concentrate (blue cap) Agilent In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: DNA Gel Matrix Vial (red cap) Agilent In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: Electrode Cleaner Agilent In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: Spin Filter Agilent Supplies of Agilent DNA 7500 kit (catalog number: 5067-1506)
Agilent DNA 7500 kit: Syringe Agilent Supplies of Agilent DNA 7500 kit (catalog number: 5067-1506)
Chip priming station Agilent 5065-4401 Supplies equipment of the 2100 Bioanayzer instrument
Cubee Mini-centrifuge GeneReach aqbd-i
Filter plate vacuum Manifold: MultiScreenHTS Vacuum Manifold Merck Millipore MSVMHTS00 Vacuum instrument for Filter plate vacuum Manifold for PCR product purification
Filter plate vacuum Manifold: Silicone stopper Merck Millipore XX2004718 Filter plate vacuum Manifold
Filter plate vacuum Manifold: Vacuum pump Merck Millipore WP6122050 Filter plate vacuum Manifold
Filter plate vacuum Manifold: Waste collection vessel Merck Millipore XX1004705 Filter plate vacuum Manifold
FragilEase Fragile X PCR kit PerkinElmer 3101-0010 For PCR amplification
FragilEase Fragile X PCR kit: Sample Diluent PerkinElmer In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 )
FragilEase PCR Buffer mix PerkinElmer In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 ), containing primers. Primer sequences: TCAGGCGCTCAGCTCCGTTTCGGTTTCA (forward)
FAM-AAGCGCCATTGGAGCCCCGCACTTCC (reverse)
FragilEase Polymerase PerkinElmer In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 )
FraXsoft analysis software PerkinElmer
NanoDrop ND-2000 Spectrophotometer Thermo Fisher
Paper towels
PCR clean up plate: NucleoFast 96 PCR plate MACHEREY-NAGEL 743100
reference DNA sample Coriell NA20240 & NA20239
S1000 96-well Thermal Cycler Bio-Rad 1852196 This can be replaced by other Thermal Cyclers (eg. Veriti™ 96-Well Thermal Cycler, Applied Biosystems, catalog number: 4375786)
TriNEST Incubator/Shaker instrument PerkinElmer 1296-0050
UltraPure DNase/RNase-Free Distilled Water Life Technologies 10977015 For 2100 Bioanalyzer electrode cleaning
Vortex-Genie 2 Scientific Industries SI-0256 (Model G560E) Conventional vortex mixer
DOWNLOAD MATERIALS LIST

Riferimenti

  1. Verkerk, A. J., et al. Identification of a gene (FMR-1) containing a CGG repeat coincident with a breakpoint cluster region exhibiting length variation in fragile X syndrome. Cell. 65, 905-914 (1991).
  2. Fu, Y. H., et al. Variation of the CGG repeat at the fragile X site results in genetic instability: resolution of the Sherman paradox. Cell. 67, 1047-1058 (1991).
  3. Antar, L. N., Li, C., Zhang, H., Carroll, R. C., Bassell, G. J. Local functions for FMRP in axon growth cone motility and activity-dependent regulation of filopodia and spine synapses. Molecular and Cellular Neurosciences. 32, 37-48 (2006).
  4. Didiot, M. C., et al. The G-quartet containing FMRP binding site in FMR1 mRNA is a potent exonic splicing enhancer. Nucleic Acids Research. 36, 4902-4912 (2008).
  5. Bechara, E. G., et al. A novel function for fragile X mental retardation protein in translational activation. PLoS Biology. 7, e16 (2009).
  6. Ascano, M., et al. FMRP targets distinct mRNA sequence elements to regulate protein expression. Nature. 492, 382-386 (2012).
  7. Kenny, P. J., et al. MOV10 and FMRP regulate AGO2 association with microRNA recognition elements. Cell Reports. 9, 1729-1741 (2014).
  8. Oberle, I., et al. Instability of a 550-base pair DNA segment and abnormal methylation in fragile X syndrome. Science. 252, 1097-1102 (1991).
  9. Hagerman, R., Lauterborn, J., Au, J., Berry-Kravis, E. Fragile X syndrome and targeted treatment trials. Results and Problems in Cell Differentiation. 54, 297-335 (2012).
  10. Hatton, D. D., et al. Autistic behavior in children with fragile X syndrome: prevalence, stability, and the impact of FMRP. American Journal of Medical Genetics Part A. 140A, 1804-1813 (2006).
  11. Mattei, J. F., Mattei, M. G., Aumeras, C., Auger, M., Giraud, F. X-linked mental retardation with the fragile X. A study of 15 families. Human Genetics. 59, 281-289 (1981).
  12. Backes, M., et al. Cognitive and behavioral profile of fragile X boys: correlations to molecular data. American Journal of Medical Genetics. 95, 150-156 (2000).
  13. Nolin, S. L., et al. Fragile X analysis of 1112 prenatal samples from 1991 to 2010. Prenatal Diagnosis. 31, 925-931 (2011).
  14. Nolin, S. L., et al. Expansion of the fragile X CGG repeat in females with premutation or intermediate alleles. American Journal of Human Genetics. 72, 454-464 (2003).
  15. Fernandez-Carvajal, I., et al. Expansion of an FMR1 grey-zone allele to a full mutation in two generations. Journal of Molecular Diagnostics. 11, 306-310 (2009).
  16. Terracciano, A., et al. Expansion to full mutation of a FMR1 intermediate allele over two generations. European Journal of Human Genetics. 12, 333-336 (2004).
  17. Garcia-Arocena, D., Hagerman, P. J. Advances in understanding the molecular basis of FXTAS. Human Molecular Genetics. 19, R83-R89 (2010).
  18. Juncos, J. L., et al. New clinical findings in the fragile X-associated tremor ataxia syndrome (FXTAS). Neurogenetics. 12, 123-135 (2011).
  19. Hagerman, R. J., et al. Intention tremor, parkinsonism, and generalized brain atrophy in male carriers of fragile X. Neurology. 57, 127-130 (2001).
  20. Conway, G. S. Premature ovarian failure and FMR1 gene mutations: an update. Annales d’endocrinologie. 71, 215-217 (2010).
  21. Conway, G. S., Hettiarachchi, S., Murray, A., Jacobs, P. A. Fragile X premutations in familial premature ovarian failure. Lancet. 346, 309-310 (1995).
  22. Van Esch, H., Buekenhout, L., Race, V., Matthijs, G. Very early premature ovarian failure in two sisters compound heterozygous for the FMR1 premutation. European Journal of Medical Genetics. 52, 37-40 (2009).
  23. Bourgeois, J. A., et al. A review of fragile X premutation disorders: expanding the psychiatric perspective. Journal of Clinical Psychiatry. 70, 852-862 (2009).
  24. Farzin, F., et al. Autism spectrum disorders and attention-deficit/hyperactivity disorder in boys with the fragile X premutation. Journal of Developmental and Behavioral Pediatrics. 27, S137-S144 (2006).
  25. Hantash, F. M., et al. FMR1 premutation carrier frequency in patients undergoing routine population-based carrier screening: insights into the prevalence of fragile X syndrome, fragile X-associated tremor/ataxia syndrome, and fragile X-associated primary ovarian insufficiency in the United States. Genetics in Medicine. 13, 39-45 (2011).
  26. Kraan, C. M., et al. FMR1 allele size distribution in 35,000 males and females: a comparison of developmental delay and general population cohorts. Genetics in Medicine. 20 (12), 1627-1634 (2018).
  27. Saul, R. A., Tarleton, J. C. FMR1-Related Disorders. GeneReviews. , (2012).
  28. Amos Wilson, J., et al. Consensus characterization of 16 FMR1 reference materials: a consortium study. Journal of Molecular Diagnostics. 10, 2-12 (2008).
  29. Kwok, Y. K., et al. Validation of a robust PCR-based assay for quantifying fragile X CGG repeats. Clinica Chimica Acta. 456, 137-143 (2016).
  30. Rousseau, F., Rouillard, P., Morel, M. L., Khandjian, E. W., Morgan, K. Prevalence of carriers of premutation-size alleles of the FMRI gene–and implications for the population genetics of the fragile X syndrome. American Journal of Human Genetics. 57, 1006-1018 (1995).
  31. Tassone, F., et al. FMR1 CGG allele size and prevalence ascertained through newborn screening in the United States. Genome Medicine. 4, 100 (2012).
  32. Dombrowski, C., et al. Premutation and intermediate-size FMR1 alleles in 10572 males from the general population: loss of an AGG interruption is a late event in the generation of fragile X syndrome alleles. Human Molecular Genetics. 11, 371-378 (2002).
  33. Cronister, A., Teicher, J., Rohlfs, E. M., Donnenfeld, A., Hallam, S. Prevalence and instability of fragile X alleles: implications for offering fragile X prenatal diagnosis. Obstetrics and Gynecology. 111, 596-601 (2008).
  34. Hayward, B. E., Kumari, D., Usdin, K. Recent advances in assays for the fragile X-related disorders. Human Genetics. 136, 1313-1327 (2017).
  35. Seltzer, M. M., et al. Prevalence of CGG expansions of the FMR1 gene in a US population-based sample. American Journal of Medical Genetics Part B Neuropsychiatrics Genetics. 259B, 589-597 (2012).
  36. Hayward, B. E., Usdin, K. Assays for determining repeat number, methylation status, and AGG interruptions in the Fragile X-related disorders. Methods in Molecular Biology. , 49-59 (1942).
  37. Orrico, A., et al. Mosaicism for full mutation and normal-sized allele of the FMR1 gene: a new case. American Journal of Medical Genetics. 78, 341-344 (1998).
  38. Schmucker, B., Seidel, J. Mosaicism for a full mutation and a normal size allele in two fragile X males. American Journal of Medical Genetics. 84, 221-225 (1999).

Tags

PCR AssayFragile X Mental Retardation-1 GeneCGG Trinucleotide RepeatsMolecular DiagnosisFragile X SyndromeFragile X-related DisordersCost-effectiveRapid ReportingDNA Sample PreparationPCR Master MixPCR Cleanup
check_url/it/59963?article_type=t

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Citazione di questo articolo
Wang, H., Zhu, X., Gui, B., Cheung, W. C., Shi, M., Yang, Z., Kwok, K. Y., Lim, R., Pietilä, S., Zhu, Y., Choy, K. W. A Robust Polymerase Chain Reaction-based Assay for Quantifying Cytosine-guanine-guanine Trinucleotide Repeats in Fragile X Mental Retardation-1 Gene. J. Vis. Exp. (151), e59963, doi:10.3791/59963 (2019).
Scarica citazione
Ristampe e autorizzazioni

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image