Ultrasound-guided cell delivery around the site of myocardial infarction in mice is a safe, effective, and convenient way of cell transplantation.
The key objective of cell therapy after myocardial infarction (MI) is to effectively enhance the cell grafted rate, and human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs) are a promising cell source for cardiac repair after ischemic damage. However, a low grafted rate is a significant obstacle for effective cardiac tissue regeneration after transplantation. This protocol shows that multiple hiPSC-CM ultrasound-guided percutaneous injections into an MI area effectively increase cell transplantation rates. The study also describes the entire hiPSC-CM culture process, pretreatment, and ultrasound-guided percutaneous delivery methods. In addition, the use of human mitochondrial DNA help detect the absence of hiPSC-CMs in other mouse organs. Lastly, this paper describes the changes in cardiac function, angiogenesis, cell size, and apoptosis at the infarcted border zone in mice 4 weeks after cell delivery. It can be concluded that echocardiography-guided percutaneous injection of the left ventricular myocardium is a feasible, relatively invasive, satisfactory, repeatable, and effective cellular therapy.
When acute MI occurs, myocardial cells in the infarcted area die quickly due to ischemia and hypoxia. Several inflammatory factors are released after cell death and rupture, while inflammatory cells infiltrate the infarcted site to cause inflammation1. Significantly, fibroblasts and collagen, both without contractility and electrical conductivity, replace the myocardial cells in the infarcted site to form scar tissue. Due to the limited regeneration capacity of cardiomyocytes in adult mammals, viable tissue formed after a large area of infarction is usually not adequate for maintaining sufficient cardiac output2. MI causes heart failure, and in severe cases of heart failure, patients can only rely on heart transplants or ventricular assist devices to maintain normal heart functions3,4.
After MI, the ideal treatment strategy is to replace the dead cardiomyocytes with newly formed cardiomyocytes, forming electromechanical coupling with healthy tissues. However, treatment options have typically adopted myocardial salvage rather than replacement. Currently, stem cell- and progenitor cell-based therapies are among the most promising strategies to promote myocardial repair after MI5. However, the transplantation of these cells has several issues, primarily the inability of adult stem cells to differentiate into cardiomyocytes and their short life span6.
The ethical issues related to the use of embryonic stem (ES) cells can be circumvented by iPSCs, which are a promising source of cells. In addition, iPSCs possess strong self-renewal capabilities and can differentiate into cardiomyocytes7. Studies have shown that hiPSC-CMs transplanted into the MI site can survive and form gap junctions with host cells8,9. However, because these transplanted cells are located in the microenvironment of ischemia and inflammation, their survival rate is extremely low10,11.
Several methods have been established to improve the survival rate of transplanted cells, such as hypoxia and heat shock pretreatment of transplanted cells12,13, genetic modification14,15, and the simultaneous transplantation of cells and capillaries16. Unfortunately, most methods are limited by complexity and high cost. Hence, the present study proposes a reproducible, convenient, relatively invasive, and effective hiPSC-CM delivery method.
Ultrasound-guided intramyocardial cell injection can be carried out with only a high-resolution small veterinary ultrasound machine and a microinjector, regardless of the site. Under ultrasound guidance, directly delivering cells under the xiphoid process from the pericardium into the myocardium in mice is a safe protocol that avoids liver and lung damage. This method can be combined simultaneously with other technologies to significantly improve the survival rate of transplanted cells.
All animal experiments in this study were reviewed and approved by the ethics committee of the Second Xiangya Hospital of Central South University. See the Table of Materials for details regarding all the materials and equipment used in this protocol. The timelines for cell injection, imaging and euthansia are as follows: t0- induce infarction, t1 week- image and implant cells, t2 weeks- image and implant cells, t4 weeks- final imaging, euthanasia and tissue collection.
1. hiPSC culture, cardiomyocyte differentiation, and cell purification
2. Preparation of hiPSC-CMs and the establishment of mouse acute myocardial infarction model
3. hiPSC-CM injection under ultrasound guidance
4. Evaluation of heart function, fluorescence labeling, transplanted cell count, myocardial infarcted area, and organ human mitochondria detection in mice 30 days after left anterior descending branch ligation
Echocardiography for evaluation of the left ventricular function of the mice in each group revealed that the MI injuries were effectively reversed in the MD group (Figure 2A). Compared with the MI group, the SD group showed increased ejection fraction (EF) (from 30% to 35%; Figure 2B) and fraction shortening (FS) (from 18% to 22%; Figure 2C) after MI. However, it is even more crucial to note that multiple injections of the hiPSC-CMs in the MD group mice percutaneously increased EF (from 30% to 42%; Figure 2B) and FS (from 18% to 28%; Figure 2C) of the mouse heart after MI.
Fluorescence labeling of nonspecific α-actin (αSA), DAPI, human-specific troponin T (hcTnT), and human nuclear antigen (HNA) of tissue sections showed that the transplanted cell count in the MD group was significantly higher than that in the SD group (Figure 3A). Although the MD group only had two more injections than the SD group, the transplanted cell count in the MD group was ~10x that of the SD group (Figure 3B). In addition, the percentage of transplanted cardiomyocytes in the MD group was also significantly higher than that in the SD group (Figure 3C). This study also showed that the transplanted cells in the MD group were distributed in the infarct area and the marginal infarct area, while the transplanted cells in the SD group were only distributed in the infarct area (Figure 3A).
The MI area in the SD treatment group was smaller than that in the MI group and the MI area in the SD group was significantly smaller than that in the MD group (Figure 2E). In addition, the thickness of the left ventricular anterior wall of the MD group was 4x that of the myocardial MI group, while the thickness of the left ventricular anterior wall in the SD group was twice that of the MI group (Figure 2F). However, the collagen volume fraction in the MD group was 50% lower than that in the MI group, while the collagen volume fraction in the SD group was only 30% lower than that in the MI group (Figure 2G).
The total count of cells expressing IB4 (an endothelial cell marker) and SM22α (a smooth muscle cell marker) 28 days after MI increased significantly in the MD group (Figure 3D,E) compared to the SD or MI group. This study also assessed the degree of hypertrophy of cardiomyocytes in the marginal zone of each group. Wheat germ agglutinin (WGA) and Sarcomeric Alpha Actinin fluorescence staining showed that the minimum fiber diameter (MFD) in ligated mice in all the three groups was significantly higher than that of the sham-ligated mice. However, the MFD of the MD group was significantly smaller than that of the MI and SD groups (Figure 3F,G). This study further used TUNEL immunostaining (which can mark the nucleus of all apoptotic cells) to evaluate the apoptosis of cardiomyocytes. Compared with the SD group or the MI group, the prevalence of TUNEL-positive cardiomyocyte nuclei in the MD group was significantly reduced (Figure 3H,I). No human mitochondrial DNA was detected in any organ in the sham and MI groups (Figure 4A,B). The MD and SD groups only showed human mitochondrial DNA in the heart, and no human mitochondrial DNA was detected in any other organ (Figure 4C,D).
Figure 1: Ultrasound-guided intramyocardial cell injection in mice. After the mouse is anesthetized on an operating table, the limbs and tail are fixed with tape at a constant temperature of 37 °C, while the percutaneous intramyocardial injection is administered in the left ventricle, guided by echocardiography. The mice were anesthetized and maintained by inhalation of isoflurane (1.5%-2%). Remove the hair on the upper abdomen and chest of the mouse. Under transthoracic echocardiography guidance, insert the tip of the microsyringe below the xiphoid process (A) (arrow) and move it (arrow) along the upper edge of the diaphragm (B) to adjust the respiratory rate of the mouse. Press the needle tip against the pericardial wall (C) in the inspiratory phase. (D,E) The needle tip enters the pericardial cavity in the expiratory phase and finally penetrates the left ventricular anterior wall (F) to inject cells. This figure was modified from17. Abbreviations: LV = left ventricle; AO = ascending aorta; RL = right lung; LL = left lung. Please click here to view a larger version of this figure.
Figure 2: Evaluation of cardiac function in mice in each group. (A) Use high-resolution echocardiography to assess the left ventricular function before inducing myocardial infarction (pre-S) and 4 weeks after treatment (post-S). The ejection fraction (B) and fraction shortening (C) are expressed as absolute values. The data are expressed as mean ± SE, 8 per group. Assess infarct size, collagen volume, and left ventricular morphology. Through Sirius red/fast green staining (D), infarct size (E), left ventricular anterior wall thickness (F), and collagen volume fraction (G) were measured. The data show mean ± SE, 8 mice per group. Scale bar = 1 mm. One-way analysis of variance and Dunn's multiple comparison test. * * p < 0.01; * * * p < 0.001; * * * * p < 0.0001. This figure was modified from17. Abbreviations: pre-S = presurgery; post-S = post surgery; MI = myocardial infarction; SD = single dose; MD = multiple dose. Please click here to view a larger version of this figure.
Figure 3: Histological evaluation of the hearts of mice in each group. (A) Serial sections of the injected heart mice with hiPSC-CM were stained for hcTnT, α-sarcomeric actin (αSA), and DAPI. The number (B) and percentage (C) of the transplanted cells were used for quantification. Serial sections from sham-operated, MI, SD, and MD-treated mouse hearts sacrificed 4 weeks after MI induction were histochemically stained for the presence of IB4. (D,E) Capillaries are quantified as the number of IB4-positive vascular structures in each high-power field area around the infarct. The cardiomyocytes were stained with WGA and αSA in the marginal zone of myocardial infarction, and the nuclei were labeled with DAPI. (F,G) The cross-sectional area of cardiomyocytes is measured and displayed as an absolute value. The marginal sections of myocardial infarction were stained with TUNEL to show apoptotic cardiomyocytes (red, TUNEL) and normal cardiomyocytes expressing cardiac troponin T (green, cTnT). (H,I) The ratio of TUNEL-positive cells to total cells was calculated. Scale bars = 500 µm (A), 20 µm (D,H), or 10 µm (F). One-way analysis of variance and Dunn's multiple comparison test. * p < 0.05; * * p < 0.01; * * * p < 0.001; * * * * p < 0.0001. This figure was modified from17. Abbreviations: hcTnT = human cardiac troponin T; αSA = α-sarcomeric actin; WGA = wheat germ agglutinin; DAPI = 4', 6-diamidino-2-phenylindole; TUNEL = terminal deoxynucleotidyl transferase dUTP nick end labeling; MI = myocardial infarction; SD = single dose; MD = multiple dose. Please click here to view a larger version of this figure.
Figure 4: Detection of human mitochondrial DNA in mouse organs in each group. The figure shows the detection of human mitochondrial DNA in mouse hearts and other organ(s) in each group 1 month after cell transplantation PCR. PCR of human mitochondrial DNA did not find transplanted cells (A,B) in the hearts and other organs of mice in the sham (n = 3) and MI group (n = 3). PCR of human mitochondrial DNA found transplanted cells in the hearts of mice in the SD (n = 3) and MD group (n = 3) but not in other organs, including the lung, liver, kidney, brain, and spleen (C,D). The qPCR quantitative analysis of human mitochondrial DNA showed that the human mitochondrial DNA of the MD group was approximately eight times that of the SD group (E). (+) indicates iPSC-CMs positive control. (−) indicates DEPC water negative control. Abbreviations: n.s. = not significant; MI = myocardial infarction; SD = single dose; MD = multiple dose. Please click here to view a larger version of this figure.
The critical steps of this study include hiPSC culture, cardiomyocyte differentiation, hiPSC-CM purification, and hiPSC-CM transplantation into the mouse myocardial infarction site. The key is to use cardiac ultrasound to transcutaneously guide treatment toward the infarct site at the edge of the infarction where hiPSC-CMs were injected into the area.
With the prolongation of culture time, the hiPSC-CM phenotype changes in morphology (larger cell size), structure (muscle, fibril density, arrangement, microscopic cell clusters), and physiology (calcium treatment and β-adrenergic response) with differentiation over time. In this study, fluorescence labeling was performed on the 10th and 60th days of hiPSC differentiation into cardiomyocytes to observe morphological and structural changes. Cell size and sarcomere length were significantly increased in hiPSC-CMs on the 60th day than on the 10th day. The study used hiPSC-CMs that were relatively stable after 60 days of differentiation into cardiomyocytes for transplantation. In addition, during the 60 days of culture of hiPSC-CMs, multiple replacements of lactic acid-containing glucose-free culture medium were performed to purify cardiomyocytes and increase cardiomyocyte content to avoid side effects caused by noncardiomyocytes in the transplanted cells.
An ultrasound probe was first placed on the mouse’s upper abdomen during ultrasound-guided cell injection to visualize its liver. The microinjector needle entered obliquely under the xiphoid process, avoiding the liver and entering the pericardium under ultrasound guidance. In this study, the pericardium was not vertically assessed from the inner bones of the chest wall as this pathway toward the infarction area in the myocardium is significantly short, posing a high risk of cardiac puncture and cell transplantation failure. However, obliquely accessing the pericardium from the xiphoid process toward the myocardium constitutes a considerably longer pathway with a lower risk of cardiac puncture. During the ultrasound-guided cell injection, the mice were intubated to regulate the respiratory rate during puncture. Regulating the respiratory rate of the mice and prolonging the inhalation and expiration times are conducive to puncture during expiration, which also avoids damaging the lungs. During this experiment, no mice died from heart rupture and lung injury following cell injection.
For the stability of transplanted cells, the study considered the time point of hiPSC-CM injection and the number of injections. In the early stage of MI, severe inflammation occurred in the infarcted area23. Early suppression of the inflammatory response at the infarct site can improve myocardial remodeling and limit fatal possibilities for the experimental subject24. In addition, a severe inflammatory response is a reason for transplanted cell death. Previous studies have shown that transplantation of ES cell-differentiated cardiomyocytes into the infarct site can inhibit the inflammatory response at the myocardial infarction site25.
After the mouse MI model was established, hiPSC-CMs were injected into the infarct site and the infarcted marginal zone under direct vision; only one-tenth of the hiPSC-CMs survived. However, the study suggests that the initially transplanted hiPSC-CMs may improve the microenvironment at the myocardial infarcted site in mice and improve the survival rate of retransplanted cells. The results showed that the number of cells that survived after three hiPSC-CM injections were 10x that of a single hiPSC-CM injection (Figure 3C). Ultrasound showed that the anterior wall thickness of the left ventricle in the MD and SD groups was much thinner at the third and fourth weeks after the MI model was established than at the first and second weeks. Thus, the mice in the MD group were injected with cells immediately after the MI model was established, and then one and two weeks after infarction to avoid death due to cardiac rupture.
This study shows that the number of grafted cells is significantly higher in the MD group than that in the SD group. The echocardiography of the mouse showed that the EF and SF values of the MD group were higher than those of the SD group. The paracrine function of the transplanted hiPSC-CMs should also be considered together with transplanted cardiomyocytes to improve heart function. A study by Iwanaga et al.26 reported that the paracrine factors secreted by hiPSC-CMs could promote angiogenesis by activating Akt1. The study found very few isolectin B4-positive cells in the marginal infarct area in the MI group. In contrast, there were more isolectin B4-positive cells in the SD and MD groups than in the MI group; notably, the MD group had the most. Thus, these results show that the more the grafted hiPSC-CMs, the stronger will be the new blood vessels at the site.
The authors have nothing to disclose.
This work was supported by the Major Research Plan of the National Natural Science Foundation of China (No. 91539111to JY), Key Project of Science and Technology of Hunan Province (No. 2020SK53420 to JY) and The Science and Technology Innovation Program of Hunan Province (2021RC2106 to CF).
Antibody | |||
Cardiac troponin T | Abcam | ab8295 | |
Donkey Anti-Mouse IgG H&L (Alexa Fluor 488) | Abcam | ab150105 | |
Donkey Anti-Mouse IgG H&L (Alexa Fluor 555) | Abcam | ab150110 | |
Donkey Anti-Rabbit IgG H&L (Alexa Fluor 488) | Abcam | ab150073 | |
Donkey Anti-Rabbit IgG H&L (Alexa Fluor 555) | Abcam | ab150062 | |
Human cardiac troponin T | Abcam | ab91605 | |
Isolectin B4 | Vector | FL-1201 | |
Sarcomeric alpha actinin | Abcam | ab9465 | |
Wheat germ agglutinin | Thermo Fisher Scientific | W11261 | |
Reagent | |||
Accutase | Thermo Fisher Scientific | 00-4555-56 | |
B27 Supplement(minus insulin) | Thermo Fisher Scientific | A1895601 | |
B27 Supplement(serum free) | Thermo Fisher Scientific | 17–504-044 | |
Bouin's solution | Thermo Fisher Scientific | SDHT10132 | |
CHIR99021 | Selleck | CT99021 | |
cyclosporin A | Medchemexpress | HY-B0579 | |
DIRECT RED | Sigma-Aldrich | 365548-25G | |
DMEM/F12 | Thermo Fisher Scientific | 11320033 | |
DNeasy Blood & Tissue Kit | Qiagen | 69504 | |
FAST GREEN FCF | Sigma-Aldrich | F7252-5G | |
Glucose-free RPMI 1640 | Thermo Fisher Scientific | 11879020 | |
IWR1 | Selleck | S7086 | |
lactic acid | Sigma-Aldrich | L6661 | |
Matrigel | BD Biosciences | BD356234 | |
mTeSR1 | Stem Cell Technologies | 72562 | |
O.C.T. Compound | SAKURA | 4583 | |
Paraformaldehyde | Sigma-Aldrich | 158127 | |
PowerUP SYBR Green MasterMix kit | Thermo Fisher Scientific | A25742 | |
RPMI1640 | Thermo Fisher Scientific | 11875119 | |
STEMdif Cardiomyocyte Freezing Medium/STEMdiff | Stem Cell Technologies | 5030 | |
STEMdiff Cardiomyocyte Support Medium | Stem Cell Technologies | 5027 | |
Triton X-100 | Sigma-Aldrich | T8787 | |
ultrasound coupling agent | CARENT | 22396269389 | |
Y-27632 | Selleck | S6390 | |
Equipment and Supplies | |||
Applied Biosystems | Thermo Fisher Scientific | 7500 Real-Time PCR | |
cryostat | Leica | CM1950 | |
fluoresence microscope | Olympus | IX83 | |
fine anatomical scissors | Fine Science Tools | 15000-08 | |
fine dissecting forceps | Fine Science Tools | 11255-20 | |
Micro syringe | Hamilton | 7633 | |
Small animal anesthesia machine | MATRX | VMR | |
Ultra-high resolution small animal ultrasound imaging system | VisualSonics | Vevo 2100 | |
Software | |||
Statistical Product and Service Solutions | IBM | 21 | |
Image J | NIH | 1.48 | |
Human mitochondrial DNA primers | |||
the forward primer sequence | CCGCTACCATAATCATCGCTAT | ||
the reverse primer sequence | TGCTAATACAATGCCAGTCAGG |