JoVE Journal > Biology
Summary
Abstract
Introduction
Protocol
Risultati
Discussion
Divulgazioni
Acknowledgements
Materials
Riferimenti
Traduzione automatica
Please note that all translations are automatically generated. Click here for the English version.
Biologia

재구성된 활성 미세소관 다발 내의 힘을 직접 측정

Published: May 10, 2022
doi:
10.3791/63819
, ,
1Department of Biological Sciences and Center for Biotechnology and Interdisciplinary Studies,Rensselaer Polytechnic Institute

Summary

여기에서는 시험관 내에서 미세소관 다발을 재구성하고 동시 광학 트래핑 및 전반사 형광 현미경을 사용하여 그 안에 가해지는 힘을 직접 정량화하는 프로토콜을 제시합니다. 이 분석은 활성 미세소관 네트워크 내에서 단백질 앙상블에 의해 생성된 힘과 변위의 나노스케일 수준 측정을 허용합니다.

Abstract

미세소관 네트워크는 소포 수송을 위한 트랙 역할을 하는 것부터 유사분열 동안 염색체 분리를 조절하기 위한 특수 어레이로 작동하는 것까지 광범위한 작업을 수행하기 위해 세포에 사용됩니다. 미세소관과 상호작용하는 단백질에는 활성력과 방향 운동을 생성할 수 있는 키네신 및 다인(dynein)과 같은 모터뿐만 아니라 필라멘트를 고차 네트워크로 가교결합하거나 필라멘트 역학을 조절하는 비모터 단백질이 포함됩니다. 현재까지 미세소관 관련 단백질에 대한 생물물리학적 연구는 소포 수송에 필요한 단일 운동 단백질의 역할에 압도적으로 초점을 맞추었으며, 키네신 및 다인인의 힘 생성 특성 및 기계화학적 조절을 밝히는 데 상당한 진전이 있었습니다. 그러나 유사분열 방추 내에서 필라멘트가 미끄러지는 동안과 같이 미세소관이 화물과 트랙 모두에서 작용하는 공정의 경우 관련된 가교 단백질 앙상블의 생물물리학적 조절에 대해서는 훨씬 덜 이해됩니다. 여기에서는 정제된 미세소관과 유사분열 단백질로 구성된 가교 미세소관 최소 네트워크 내에서 힘 생성 및 반응을 직접 프로빙하는 방법론에 대해 자세히 설명합니다. 미세소관 쌍은 관심 단백질에 의해 가교되고, 하나의 미세소관은 현미경 커버슬립에 고정되고, 두 번째 미세소관은 광학 트랩에 의해 조작됩니다. 동시 전반사 형광 현미경을 사용하면 필라멘트가 떨어져 힘을 생성할 때 이 미세소관 네트워크의 모든 구성 요소를 다채널 시각화할 수 있습니다. 또한 이러한 기술을 사용하여 키네신-5 앙상블이 가하는 미는 힘을 조사하는 방법과 유사분열 MAP PRC1에 의해 가교된 슬라이딩 미세소관 쌍 사이에서 점성 제동력이 어떻게 발생하는지 보여줍니다. 이러한 분석은 스핀들 조립 및 기능의 메커니즘에 대한 통찰력을 제공하며 뉴런 및 극성 상피 세포의 축삭 및 수상 돌기와 같은 다양한 맥락에서 조밀 한 미세 소관 네트워크 역학을 연구하는 데 더 광범위하게 적용될 수 있습니다.

Introduction

세포는 미세소관 네트워크를 사용하여 소포 수송 1,2,3에서 유사분열 4,5,6 동안 염색체 분리에 이르기까지 다양한 기계적 작업을 수행합니다. 분자 운동 단백질 키네신 및 다인(dynein)과 같이 미세소관과 상호 작용하는 많은 단백질은 힘을 생성하고 기계적 부하에 의해 조절됩니다. 이러한 중요한 분자가 어떻게 기능하는지 더 잘 이해하기 위해 연구자들은 광학 트래핑 및 TIRF 현미경과 같은 단일 분자 생물 물리학 적 방법을 사용하여 무부하 스테핑 속도, 처리 성 및 개별 단백질에 대한 힘-속도 관계와 같은 중요한 매개 변수를 직접 모니터링했습니다. 가장 일반적으로 사용되는 실험 기하학은 구형 기하학과 크기가 모터 구동 수송을 받는 소포를 모방한 트래핑 비드에 모터 단백질을 직접 부착하는 것이었습니다. 키네신 -1 7,8,9, 키네신 -2 10,11,12, 키네 신 -313,14,15,16 키네신 -517,18, 키네 신 –8 19,20, 다인 및 다인 복합체21,22, 23,24,25, 이러한 방법으로 연구되었습니다.

그러나 많은 세포 과정에서 운동 및 비 운동 단백질은 트랙 및화물26,27로 미세 소관을 사용합니다. 또한, 미세 소관 필라멘트가 고차 다발로 가교 결합되는 이러한 시나리오에서 이러한 단백질은 단일 단위가 아닌 앙상블로 기능합니다. 예를 들어, 분열하는 체세포 내에서, 조밀한 필라멘트 네트워크는 유사분열 방추 장치(28,29,30)를 구축하기 위해 자기 조직화된다. 극간 스핀들 미세 소관 네트워크는 매우 역동적이며 스핀들 극을 가리키는 마이너스 엔드와 스핀들 적도 근처에서 겹치는 플러스 엔드로 크게 배열됩니다. 스핀들 내의 필라멘트는 운동 단백질, 예컨대 키네신-5 31,32,33, 키네신-12 34,35,36 및 키네신-1437,38,39 또는 PRC140,41,42,43 또는 NuMA 44,45와 같은 비-운동 단백질에 의해 가교되고, 46. 그들은 극 플럭스와 같은 과정에서 또는 중기 동안 염색체 중심을 조정하는 동안 또는 아나 페이즈 47,48,49,50,51,52 동안 염색체 분리를 조정하는 동안 자주 움직이거나 기계적 스트레스를 경험합니다. 따라서 유사 분열을 통한 미크론 규모의 스핀들 장치의 무결성은이 상호 작용하는 필라멘트 네트워크에 의해 생성되고 유지되는 밀고 당기는 힘의 신중하게 조절 된 균형에 의존합니다. 그러나 이 기계적 조절을 조사하고 단백질 앙상블이 어떻게 함께 작동하여 미세소관 운동을 조정하고 스핀들을 적절하게 조립하는 데 필요한 힘을 생성하는지 설명하는 데 필요한 도구는 최근에야 개발되었으며 동적 미세소관 네트워크를 정의하는 생물물리학적 규칙을 이해하기 시작했습니다.

이 원고의 목표는 시험관 내에서 가교결합된 미세소관 쌍을 재구성하고, 미세소 관과 가교 단백질의 동시 형광 시각화 및 나노스케일 힘 측정을 허용하는 현미경 챔버에서 이러한 번들을 고정하고, 이러한 데이터를 강력하게 처리하는 데 필요한 단계를 시연하는 것입니다. 형광 표지 미세소관을 안정적으로 중합하고, 부착용 현미경 커버슬립을 준비하고, 광학 트래핑 실험을 위한 폴리스티렌 비드를 준비하고, 직접적인 생물물리학적 조작을 허용하면서 생체 내 기능을 보존하는 가교 필라멘트 네트워크를 조립하는 데 필요한 단계를 자세히 설명합니다.

Protocol

1. 미세소관의 제조 참고: GFP 표지된 가교 단백질을 사용할 때 미세소관의 적색(예: 로다민) 및 원적색(예: 비오티닐화된 HiLyte647, 텍스트의 나머지 부분에서 비오티닐화된 원적색이라고 함)이 잘 작동합니다. 고품질 쿼드 밴드 전반사 형광(TIRF) 필터를 사용하여 이미징 중에 세 채널 간의 누화를 최소화할 수 있습니다. GMPCPP 미세소관 종자 재고 준비84 ?…

Representative Results

생물 물리학 적 분석에 적합한 미세 소관 번들의 준비는 몇 가지 주요 기준이 충족되면 성공한 것으로 간주됩니다. 첫째, 세 가지 색상의 이미징은 중첩 영역을 우선적으로 장식하는 가교 단백질 농도를 가진 두 개의 정렬 된 미세 소관을 나타내야합니다 (그림 5B, C 및 그림 6B). 이상적으로, 로다민 미세소관의 중첩 가장자리와 …

Discussion

미세소관 네트워크는 본질적으로 근본적으로 기계적인 광범위한 작업을 수행하기 위해 무수한 세포 유형에 사용됩니다. 세포가 건강한 상태와 질병 상태 모두에서 어떻게 기능하는지 설명하려면 이러한 미크론 규모의 네트워크가 집합적으로 구축하는 나노미터 크기의 단백질에 의해 어떻게 구성되고 조절되는지 이해하는 것이 중요합니다. 광학 핀셋과 같은 생물물리학적 도구는 이 규모에서 ?…

Divulgazioni

The authors have nothing to disclose.

Acknowledgements

저자는 R21 AG067436 (JP 및 SF), T32 AG057464 (ET) 및 Rensselaer Polytechnic Institute School of Science Startup Funds (SF)의 지원을 인정하고자합니다.

Materials

10W Ytterbium Fiber Laser, 1064nm IPG Photonics YLR-10-1064-LP
405/488/561/640nm Laser Quad Band Set for TIRF applications Chroma TRF89901v2
6x His Tag Antibody, Biotin Conjugate Invitrogen #MA1-21315-BTIN
Acetone, HPLC grade Fisher Scientific 18-608-395
Alpha casein from bovine milk Sigma 1002484390
ATP Fisher Scientific BP413-25
Benzonase Novagen 70746-3
Biotin-PEG-SVA-5000 Laysan Bio, Inc. NC0479433
BL21 (DE3) Rosetta Cells Millipore Sigma 71-400-3
Catalase MP Biomedicals LLC 190311
CFI Apo 100X/1.49NA oil immersion TIRF objective Nikon N/A
Chloramphenicol ACROS Organics 227920250
Coverslip Mini-Rack, for 8 coverslips Fisher Scientific C14784
Delicate Task Wipers Kimberly-Clark 34120
Dextrose Anhydrous Fisher Scientific BP3501
D-Sucrose Fisher Scientific BP220-1
DTT Fisher Scientific BP172-25
Ecoline Immersion Thermostat E100 with 003 Bath LAUDA-Brinkmann 27709
EDTA Fisher Scientific BP118-500
EGTA Millipore Corporation 32462-25GM
FIJI / Image J https://fiji.sc/ N/A
Frosted Microscope Slides Corning 12-553-10 75mmx25mm, with thickness of 0.9-1.1mm
Glucose Oxidase MP Biomedicals LLC 195196 Type VII, without added oxygen
GMPCPP Jena Biosciences JBS-NU-405S Can be stored for several months at -20 °C and up to a year at -80 °C
Gold Seal-Cover Glass Thermo Scientific 3405
HEPES Fisher Scientific BP310-500
Imidazole Fisher Scientific 03196-500
IPTG Fisher Scientific BP1755-10
Laboratory dessicator Bel-Art 999320237 190mm plate size
Kanamycin Sulfate Fischer Scientific BP906-5
KIF5A K439 (aa:1-439)-6His Gilbert Lab, RPI N/A doi.org/10.1074/jbc.RA118.002182
Kimwipe Kimberley Clark Z188956 lint-free tissue
Immersion Oil, Type B Cargille 16484
Lens Tissue ThorLabs MC-5
LuNA Laser launch (4 channel: 405, 488, 561, 640nm) Nikon N/A
Lysozyme MP Biomedicals LLC 100834
Magnesium Acetate Tetrahydrate Fisher Scientific BP215-500
Microfuge 18 Beckman Coulter 367160
MPEG-SVA MW-5000 Laysan Bio, Inc. NC0107576
Neutravadin Invitrogen PI31000
Nikon Ti-E inverted microscope Nikon N/A Nikon LuN4 Laser
Ni-NTA Resin Thermo Scientific 88221
Oligonucleotide – CACCTATTCTGAGTTTGCGCGA
GAACTTTCAAAGGC		 IDT N/A
Oligonucleotide – GCCTTTGAAAGTTCTCGCGCAA
ACTCAGAATAGGTG		 IDT N/A
Open-top thickwall polycarbonate tube, 0.2 mL, 7 mm x 22 mm Beckman Coulter 343755
Optima-TLX Ultracentrifuge Beckman Coulter 361544
Paclitaxel (Taxol equivalent) Thermo Fisher Scientific P3456
PIPES ACROS Organics 172615000
PMSF Millipore 7110-5GM
Porcine Tubulin, biotin label Cytoskeleton, Inc. T333P
Porcine Tubulin, HiLyte 647 Fluor Cytoskeleton, Inc. TL670M far red labelled
Porcine Tubulin, Rhodamine Cytoskeleton, Inc. TL590M
Porcine Tubulin, Tubulin Protein Cytoskeleton, Inc. T240
Potassium Acetate Fisher Scientific BP364-500
Prime 95B sCMOS camera Photometric N/A
Quadrant Detector Sensor Head ThorLabs PDQ80A
Quikchange Lightning Kit Agilent Technologies 210518
Sodium Bicarbonate Fisher Scientific S233-500
Sodium Phosphate Dibasic Anhydrous Fisher Scientific BP332-500
Square Cover Glasses Corning 12-553-450 18 mm x 18 mm, with thickness of 0.13-0.17 mm
Streptavidin Microspheres Polysciences Inc. 24162-1
Superose-6 Column GE Healthcare 29-0915–96
TCEP Thermo Scientific 77720
TLA-100 Fixed-Angle Rotor Beckman Coulter 343840
Ultrasonic Cleaner (Sonicator) Vevor JPS-08A(DD) 304 stainless steel, 40 kHz frequency, 60 W power
Vectabond APTES solution Vector Laboratories SP-1800-7
Windex Powerized Glass Cleaner with Ammonia-D S.C. Johnson SJN695237
DOWNLOAD MATERIALS LIST

Riferimenti

  1. Bentley, M., Banker, G. The cellular mechanisms that maintain neuronal polarity. Nature Reviews Neuroscience. 17 (10), 611-622 (2016).
  2. Yang, R., et al. A novel strategy to visualize vesicle-bound kinesins reveals the diversity of kinesin-mediated transport. Traffic. 20 (11), 851-866 (2019).
  3. Hirokawa, N., Niwa, S., Tanaka, Y. Molecular motors in neurons: Transport mechanisms and roles in brain function, development, and disease. Neuron. 68 (4), 610-638 (2010).
  4. Helmke, K. J., Heald, R., Wilbur, J. D. Interplay between spindle architecture and function. International Review of Cell and Molecular Biology. 306, (2013).
  5. Elting, M. W., Suresh, P., Dumont, S. The spindle: integrating architecture and mechanics across scales. Trends in Cell Biology. 28 (11), 896-910 (2018).
  6. Kapoor, T. Metaphase spindle assembly. Biologia. 6 (1), 8 (2017).
  7. Svoboda, K., Block, S. M. Force and velocity measured for single kinesin molecules. Cell. 77 (5), 773-784 (1994).
  8. Svoboda, K., Schmidt, C. F., Schnapp, B. J., Block, S. M. Direct observation of kinesin stepping by optical trapping interferometry. Nature. 365 (6448), 721-727 (1993).
  9. Schnitzer, M. J., Visscher, K., Block, S. M. Force production by single kinesin motors. Nature Cell Biology. 2 (10), 718-723 (2000).
  10. Andreasson, J. O. L., Shastry, S., Hancock, W. O., Block, S. M. The mechanochemical cycle of mammalian kinesin-2 KIF3A/B under load. Current Biology. 25 (9), 1166-1175 (2015).
  11. Bensel, B. M. The mechanochemistry of the kinesin-2 kif3ac heterodimer is related to strain-dependent kinetic properties of kif3a and kif3c. Proceedings of the National Academy of Sciences of the United States of America. 117 (27), 15632-15641 (2020).
  12. Gilbert, S. P., Guzik-Lendrun, S., Rayment, I. Kinesin-2 motors: kinetics and biophysics. Journal of Biological Chemistry. 293 (12), 4510-4518 (2018).
  13. Okada, Y., Higuchi, H., Hirokawa, N. Processivity of the single-headed kinesin KIF1A through binding to tubulin. Nature. 424 (6948), 574-577 (2003).
  14. Budaitis, B. G., et al. Pathogenic mutations in the kinesin-3 motor KIF1A diminish force generation and movement through allosteric mechanisms. Journal of Cell Biology. 220 (4), 202004227 (2021).
  15. Tomishige, M., Klopfenstein, D. R., Vale, R. D. Conversion of Unc104/KIF1A kinesin into a processive motor after dimerization. Science. 297 (5590), 2263-2267 (2002).
  16. Siddiqui, N., et al. Force generation of KIF1C is impaired by pathogenic mutations. bioRxiv. , (2021).
  17. Valentine, M. T., Fordyce, P. M., Krzysiak, T. C., Gilbert, S. P., Block, S. M. Individual dimers of the mitotic kinesin motor Eg5 step processively and support substantial loads in vitro. Nature Cell Biology. 8 (5), 470-476 (2006).
  18. Valentine, M. T., Gilbert, S. P. To step or not to step? How biochemistry and mechanics influence processivity in Kinesin and Eg5. Current Opinion in Cell Biology. 19 (1), 75-81 (2007).
  19. Jannasch, A., Bormuth, V., Storch, M., Howard, J., Schäffer, E. Kinesin-8 is a low-force motor protein with a weakly bound slip state. Biophysical Journal. 104 (11), 2456-2464 (2013).
  20. Bormuth, V., Varga, V., Howard, J., Schäffer, E. Protein friction limits diffusive and directed movements of kinesin motors on microtubules. Science. 325 (5942), 870-873 (2009).
  21. Gennerich, A., Carter, A. P., Reck-Peterson, S. L., Vale, R. D. Force-induced bidirectional stepping of cytoplasmic dynein. Cell. 131 (5), 952-965 (2007).
  22. Mallik, R., Carter, B. C., Lex, S. A., King, S. J., Gross, S. P. Cytoplasmic dynein functions as a gear in response to load. Nature. 427 (6975), 649-652 (2004).
  23. Redwine, W. B., et al. The human cytoplasmic dynein interactome reveals novel activators of motility. eLife. 6, 28257 (2017).
  24. Belyy, V., Hendel, N. L., Chien, A., Yildiz, A. Cytoplasmic dynein transports cargos via load-sharing between the heads. Nature Communications. 5 (1), 5544 (2014).
  25. Belyy, V., et al. The mammalian dynein-dynactin complex is a strong opponent to kinesin in a tug-of-war competition. Nature Cell Biology. 18 (9), 1018-1024 (2016).
  26. Subramanian, R., Kapoor, T. M. Building complexity: insights into self-organized assembly of microtubule-based architectures. Developmental Cell. 23 (5), 874-885 (2012).
  27. Forth, S., Kapoor, T. M. The mechanics of microtubule networks in cell division. Journal of Cell Biology. 216 (6), 1525-1531 (2017).
  28. Dumont, S., Mitchison, T. J. Force and length in the mitotic spindle. Current Biology. 19 (17), 749-761 (2009).
  29. McIntosh, J. R., Molodtsov, M. I., Ataullakhanov, F. I. Biophysics of mitosis. Quarterly Reviews of Biophysics. 45 (2), 147-207 (2012).
  30. McIntosh, J., Hays, T. A brief history of research on mitotic mechanisms. Biologia. 5 (4), 55 (2016).
  31. Ferenz, N. P., Gable, A., Wadsworth, P. Mitotic functions of kinesin-5. Seminars in Cell and Developmental Biology. 21 (3), 255-259 (2010).
  32. Kapitein, L. C., et al. The bipolar mitotic kinesin Eg5 moves on both microtubules that it crosslinks. Nature. 435 (7038), 114-118 (2005).
  33. Vukušić, K., Ponjavić, I., Buđa, R., Risteski, P., Tolić, I. M. Microtubule-sliding modules based on kinesins EG5 and PRC1-dependent KIF4A drive human spindle elongation. Developmental Cell. 56 (9), 1253-1267 (2021).
  34. Sturgill, E. G., Ohi, R. Kinesin-12 differentially affects spindle assembly depending on its microtubule substrate. Current Biology. 23 (14), 1280-1290 (2013).
  35. Drechsler, H., McHugh, T., Singleton, M. R., Carter, N. J., McAinsh, A. D. The Kinesin-12 Kif15 is a processive track-switching tetramer. eLife. 3, 01724 (2014).
  36. Tanenbaum, M. E., et al. Kif15 Cooperates with Eg5 to promote bipolar spindle assembly. Current Biology. 19 (20), 1703-1711 (2009).
  37. Mountain, V., et al. Cross-links microtubules in the mammalian mitotic spindle. Journal of Cell Biology. 147 (2), 351-365 (1999).
  38. Norris, S. R., et al. Microtubule minus-end aster organization is driven by processive HSET-tubulin clusters. Nature Communications. 9 (1), 2659 (2018).
  39. Cai, S., Weaver, L. N., Ems-McClung, S. C., Walczak, C. E. Proper organization of microtubule minus ends is needed for midzone stability and cytokinesis. Current Biology. 20 (9), 880-885 (2010).
  40. Pamula, M. C., et al. High-resolution imaging reveals how the spindle midzone impacts chromosome movement. Journal of Cell Biology. 218 (8), 2529-2544 (2019).
  41. Bieling, P., Telley, I. A., Surrey, T. A minimal midzone protein module controls formation and length of antiparallel microtubule overlaps. Cell. 142 (3), 420-432 (2010).
  42. Zhu, C., Lau, E., Schwarzenbacher, R., Bossy-Wetzel, E., Jiang, W. Spatiotemporal control of spindle midzone formation by PRC1 in human cells. Proceedings of the National Academy of Sciences of the United States of America. 103 (16), 6196-6201 (2006).
  43. Subramanian, R., et al. Insights into antiparallel microtubule crosslinking by PRC1, a conserved nonmotor microtubule binding protein. Cell. 142 (3), 433-443 (2010).
  44. Elting, M. W., Prakash, M., Udy, D. B., Dumont, S. Mapping load-bearing in the mammalian spindle reveals local kinetochore fiber anchorage that provides mechanical isolation and redundancy. Current Biology. 27 (14), 2112-2122 (2017).
  45. Fant, X., Merdes, A., Haren, L. Cell and molecular biology of spindle poles and NuMA. International Review of Cytology. 238, 1-57 (2004).
  46. Merdes, A., Heald, R., Samejima, K., Earnshaw, W. C., Cleveland, D. W. Formation of spindle poles by dynein/dynactin-dependent transport of NuMA). Journal of Cell Biology. 149 (4), 851-861 (2000).
  47. Maddox, P., Straight, A., Coughlin, P., Mitchison, T. J., Salmon, E. D. Direct observation of microtubule dynamics at kinetochores in Xenopus extract spindles: Implications for spindle mechanics. Journal of Cell Biology. 162 (3), 377-382 (2003).
  48. Maddox, P., Desai, A., Oegema, K., Mitchison, T. J., Salmon, E. D. Poleward microtubule flux is a major component of spindle dynamics and anaphase A in mitotic Drosophila embryos. Current Biology. 12 (19), 1670-1674 (2002).
  49. LaFountain, J. R., Cohan, C. S., Siegel, A. J., LaFountain, D. J. Direct visualization of microtubule flux during metaphase and anaphase in crane-fly spermatocytes. Molecular Biology of the Cell. 15 (12), 5724-5732 (2004).
  50. Pavin, N., Tolić, I. M. Mechanobiology of the mitotic spindle. Developmental Cell. 56 (2), 192-201 (2021).
  51. Vukušić, K., Tolić, I. M. Anaphase B: Long-standing models meet new concepts. Seminars in Cell and Developmental Biology. 117, 127-139 (2021).
  52. Vukušić, K., et al. Microtubule sliding within the bridging fiber pushes kinetochore fibers apart to segregate chromosomes. Developmental Cell. 43 (1), 11-23 (2017).
  53. Shimamoto, Y., Forth, S., Kapoor, T. M. Measuring pushing and braking forces generated by ensembles of kinesin-5 crosslinking two microtubules. Developmental Cell. 34 (6), 669-681 (2015).
  54. Gaska, I., Armstrong, M. E., Alfieri, A., Forth, S. The mitotic crosslinking protein PRC1 acts like a mechanical dashpot to resist microtubule sliding. Developmental Cell. 54 (3), 367-378 (2020).
  55. Woll, K. A., et al. An allosteric propofol-binding site in kinesin disrupts kinesin-mediated processive movement on microtubules. Journal of Biological Chemistry. 293 (29), 11283-11295 (2018).
  56. Forth, S., Hsia, K. C., Shimamoto, Y., Kapoor, T. M. Asymmetric friction of nonmotor MAPs can lead to their directional motion in active microtubule networks. Cell. 157 (2), 420-432 (2014).
  57. Alfieri, A., Gaska, I., Forth, S. Two modes of PRC1-mediated mechanical resistance to kinesin-driven microtubule network disruption. Current Biology. 31 (12), 2495-2506 (2021).
  58. Koch, M. D., Shaevitz, J. W. Introduction to optical tweezers. Methods in Molecular Biology. 1486, 3-24 (2017).
  59. Sarshar, M., Wong, W. T., Anvari, B. Comparative study of methods to calibrate the stiffness of a single-beam gradient-force optical tweezers over various laser trapping powers. Journal of Biomedical Optics. 19 (11), 115001 (2014).
  60. Van Mameren, J., Wuite, G. J. L., Heller, I. Introduction to optical tweezers: Background, system designs, and commercial solutions. Methods in Molecular Biology. 783, 1-20 (2011).
  61. Bodrug, T., et al. The kinesin-5 tail domain directly modulates the mechanochemical cycle of the motor domain for anti-parallel microtubule sliding. eLife. 9, 51131 (2020).
  62. Reinemann, D. N., et al. Collective force regulation in anti-parallel microtubule gliding by dimeric Kif15 kinesin motors. Current Biology. 27 (18), 2810-2820 (2017).
  63. Reinemann, D. N., Norris, S. R., Ohi, R., Lang, M. J. Processive kinesin-14 HSET exhibits directional flexibility depending on motor traffic. Current Biology:CB. 28 (14), 2356-2362 (2018).
  64. Shimamoto, Y., Forth, S., Kapoor, T. M. Measuring pushing and braking forces generated by ensembles of kinesin-5 crosslinking two microtubules. Developmental Cell. 34 (6), 669-681 (2015).
  65. . SMART – Servier Medical ART Available from: https://smart.servier.com/ (2022)
  66. Gaska, I., Armstrong, M., Alfieri, A., Forth, S. The mitotic crosslinking protein PRC1 acts as a mechanical dashpot to resist microtubule sliding. Developmental Cell. 54 (3), 1-14 (2020).
  67. Janson, M. E., De Dood, M. E., Dogterom, M. Dynamic instability of microtubules is regulated by force. Journal of Cell Biology. 161 (6), 1029-1034 (2003).
  68. Kerssemakers, J. W. J., et al. Assembly dynamics of microtubules at molecular resolution. Nature. 442 (7103), 709-712 (2006).
  69. Powers, A. F., et al. The Ndc80 kinetochore complex forms load-bearing attachments to dynamic microtubule tips via biased diffusion. Cell. 136 (5), 865-875 (2009).
  70. Akiyoshi, B., et al. Tension directly stabilizes reconstituted kinetochore-microtubule attachments. Nature. 468 (7323), 576-579 (2010).
  71. Fong, K. K., et al. Direct measurement of the strength of microtubule attachment to yeast centrosomes. Molecular Biology of the Cell. 28 (14), 1853-1861 (2017).
  72. Kikumoto, M., Kurachi, M., Tosa, V., Tashiro, H. Flexural rigidity of individual microtubules measured by a buckling force with optical traps. Biophysical Journal. 90 (5), 1687-1696 (2006).
  73. Memet, E., et al. Microtubules soften due to cross-sectional flattening. eLife. 7, 34695 (2018).

Tags

Microtubule BundlesCytoskeletal NetworksForce MeasurementOptical TrapTIRF MicroscopySingle-molecule ExperimentsProtein ConcentrationProtein DensityMitosisNeural DevelopmentMuscle ContractionCell MigrationStreptavidinNeutrAvidinCaseinBiotinylated MicrotubulesRhodamine MicrotubulesRigor Kinesin-coated BeadsReaction Buffer
check_url/it/63819?article_type=t

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Citazione di questo articolo
Palumbo, J., Tai, E., Forth, S. Directly Measuring Forces Within Reconstituted Active Microtubule Bundles. J. Vis. Exp. (183), e63819, doi:10.3791/63819 (2022).
Scarica citazione
Ristampe e autorizzazioni

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image