JoVE Journal > Biology
Summary
Abstract
Introduction
Protocol
Risultati
Discussion
Divulgazioni
Acknowledgements
Materials
Riferimenti
Traduzione automatica
Please note that all translations are automatically generated. Click here for the English version.
Biologia

Direkt mätning av krafter i rekonstituerade aktiva mikrotubulibuntar

Published: May 10, 2022
doi:
10.3791/63819
, ,
1Department of Biological Sciences and Center for Biotechnology and Interdisciplinary Studies,Rensselaer Polytechnic Institute

Summary

Här presenterar vi ett protokoll för rekonstituering av mikrotubulibuntar in vitro och direkt kvantifiera de krafter som utövas inom dem med hjälp av samtidig optisk fångst och total intern reflektionsfluorescensmikroskopi. Denna analys möjliggör mätning på nanonivå av de krafter och förskjutningar som genereras av proteinensembler inom aktiva mikrotubulinätverk.

Abstract

Mikrotubuli nätverk används i celler för att utföra ett brett spektrum av uppgifter, allt från att fungera som spår för vesikeltransport till att arbeta som specialiserade arrays under mitos för att reglera kromosomsegregering. Proteiner som interagerar med mikrotubuli inkluderar motorer som kinesiner och dynein, som kan generera aktiva krafter och riktningsrörelse, liksom icke-motoriska proteiner som tvärbinder filament till högre ordningsnätverk eller reglerar filamentdynamik. Hittills har biofysiska studier av mikrotubuliassocierade proteiner överväldigande fokuserat på rollen som enmotoriga proteiner som behövs för vesikeltransport, och betydande framsteg har gjorts för att belysa de kraftgenererande egenskaperna och mekanokemisk reglering av kinesiner och dyneiner. För processer där mikrotubuli fungerar både som last och spår, såsom under filamentglidning i den mitotiska spindeln, förstås mycket mindre om den biofysiska regleringen av ensembler av de tvärbindande proteinerna som är inblandade. Här beskriver vi vår metodik för direkt sonderande kraftgenerering och respons inom tvärbundna mikrotubuli minimala nätverk rekonstituerade från renade mikrotubuli och mitotiska proteiner. Mikrotubulipar är tvärbundna av proteiner av intresse, en mikrotubuli immobiliseras till ett mikroskopskydd och den andra mikrotubulen manipuleras av en optisk fälla. Samtidig total intern reflektionsfluorescensmikroskopi möjliggör flerkanalig visualisering av alla komponenter i detta mikrotubulinätverk när filamenten glider isär för att generera kraft. Vi demonstrerar också hur dessa tekniker kan användas för att undersöka tryckkrafter som utövas av kinesin-5-ensembler och hur viskösa bromskrafter uppstår mellan glidande mikrotubulipar tvärbundna av den mitotiska MAP PRC1. Dessa analyser ger insikter i mekanismerna för spindelmontering och funktion och kan anpassas bredare för att studera tät mikrotubulinätverksmekanik i olika sammanhang, såsom axon och dendriter av neuroner och polära epitelceller.

Introduction

Celler använder mikrotubulinätverk för att utföra en mängd olika mekaniska uppgifter, allt från vesikeltransport 1,2,3 till kromosomsegregering under mitos 4,5,6. Många av de proteiner som interagerar med mikrotubuli, såsom de molekylära motorproteinerna kinesin och dynein, genererar krafter och regleras av mekaniska belastningar. För att bättre förstå hur dessa kritiska molekyler fungerar har forskare använt enmolekylära biofysiska metoder, såsom optisk fångst och TIRF-mikroskopi, för att direkt övervaka kritiska parametrar som lossade steghastigheter, processivitet och krafthastighetsrelationer för enskilda proteiner. Den vanligaste experimentella geometrin har varit att fästa motorproteiner direkt på fångpärlor vars sfäriska geometri och storlek efterliknar vesiklar som genomgår motordriven transport. Många kinesiner, inklusive kinesin-1 7,8,9, kinesin-2 10,11,12, kinesin-3 13,14,15,16 kinesin-517,18, kinesin-8 19,20, samt dynein- och dyneinkomplex21,22, 23,24,25, har studerats med dessa metoder.

I många cellulära processer använder dock motoriska och icke-motoriska proteiner mikrotubuli både som spår och last26,27. Dessutom, i dessa scenarier där mikrotubulifilament är tvärbundna till högre ordningens buntar, fungerar dessa proteiner som ensembler snarare än enskilda enheter. Till exempel, inom delande somatiska celler, organiserar täta filamentnätverk sig själv för att bygga den mitotiska spindelapparaten28,29,30. Det interpolära spindelmikrotubulinätverket är mycket dynamiskt och är till stor del anordnat med minusändar som pekar mot spindelpolerna och plusändarna som överlappar varandra nära spindelekvatorn. Filament i spindeln är tvärbundna av motorproteiner såsom kinesin-5 31,32,33, kinesin-12 34,35,36 och kinesin-1437,38,39, eller av icke-motoriska proteiner såsom PRC1 40,41,42,43 eller NuMA 44,45, 46. De rör sig ofta eller upplever mekanisk stress under processer som polewardflöde eller när de samordnar kromosomcentrering under metafas- eller kromosomsegregering under anafas 47,48,49,50,51,52. Integriteten hos spindelapparaten i mikronskala genom mitos är därför beroende av en noggrant reglerad balans mellan tryck- och dragkrafter som genereras och upprätthålls av detta nätverk av interagerande filament. Men de verktyg som behövs för att undersöka denna mekaniska reglering och förklara hur proteinensembler arbetar tillsammans för att samordna mikrotubulirörelser och producera de krafter som behövs för att korrekt montera spindeln har först nyligen utvecklats, och vi har precis börjat förstå de biofysiska reglerna som definierar dynamiska mikrotubulinätverk.

Målet med detta manuskript är att demonstrera de steg som krävs för att rekonstituera tvärbundna mikrotubulipar in vitro, immobilisera dessa buntar i en mikroskopikammare som möjliggör samtidig fluorescensvisualisering av både mikrotubuli och tvärbindande proteiner och nanoskala kraftmätning och bearbeta dessa data robust. Vi beskriver de steg som behövs för att stabilt polymerisera fluorescensmärkta mikrotubuli, förbereda mikroskopskydd för fastsättning, förbereda polystyrenpärlor för optiska fångstexperiment och montera tvärbundna filamentnätverk som bevarar deras in vivo-funktionalitet samtidigt som de möjliggör direkt biofysisk manipulation.

Protocol

1. Beredning av mikrotubuli OBS: Vid användning av GFP-märkta tvärbindningsproteiner fungerar röd (t.ex. rhodamin) och långröd (t.ex. biotinylerad HiLyte647, kallad biotinylerad långt röd i resten av texten) organisk fluoroformärkning av mikrotubuli bra. Minimal överhörning mellan alla tre kanalerna kan uppnås under avbildning med hjälp av ett högkvalitativt TIRF-filter (Total Internal Reflection Fluorescence). Förbered GMPCPP mikrotubulifrölager<…

Representative Results

Beredningen av mikrotubulibuntar som är lämpliga för biofysisk analys anses vara framgångsrik om flera av nyckelkriterierna är uppfyllda. För det första bör avbildning i tre färger avslöja två inriktade mikrotubuli med en koncentration av tvärbindande protein som företrädesvis dekorerar överlappningsområdet (figur 5B, C och figur 6B). Helst bör avståndet mellan överlappningskanten och den fria änden av rhodam…

Discussion

Mikrotubuli nätverk används av otaliga celltyper för att utföra ett brett spektrum av uppgifter som är fundamentalt mekaniska till sin natur. För att beskriva hur celler fungerar i både friska och sjukdomstillstånd är det viktigt att förstå hur dessa nätverk i mikronskala organiseras och regleras av de nanometerstora proteiner som tillsammans bygger dem. Biofysiska verktyg som optisk pincett är väl lämpade för att undersöka mekanokemin hos nyckelproteiner i denna skala. Komplexa experimentella geometrier…

Divulgazioni

The authors have nothing to disclose.

Acknowledgements

Författarna vill erkänna stöd från R21 AG067436 (till JP och SF), T32 AG057464 (till ET) och Rensselaer Polytechnic Institute School of Science Startup Funds (till SF).

Materials

10W Ytterbium Fiber Laser, 1064nm IPG Photonics YLR-10-1064-LP
405/488/561/640nm Laser Quad Band Set for TIRF applications Chroma TRF89901v2
6x His Tag Antibody, Biotin Conjugate Invitrogen #MA1-21315-BTIN
Acetone, HPLC grade Fisher Scientific 18-608-395
Alpha casein from bovine milk Sigma 1002484390
ATP Fisher Scientific BP413-25
Benzonase Novagen 70746-3
Biotin-PEG-SVA-5000 Laysan Bio, Inc. NC0479433
BL21 (DE3) Rosetta Cells Millipore Sigma 71-400-3
Catalase MP Biomedicals LLC 190311
CFI Apo 100X/1.49NA oil immersion TIRF objective Nikon N/A
Chloramphenicol ACROS Organics 227920250
Coverslip Mini-Rack, for 8 coverslips Fisher Scientific C14784
Delicate Task Wipers Kimberly-Clark 34120
Dextrose Anhydrous Fisher Scientific BP3501
D-Sucrose Fisher Scientific BP220-1
DTT Fisher Scientific BP172-25
Ecoline Immersion Thermostat E100 with 003 Bath LAUDA-Brinkmann 27709
EDTA Fisher Scientific BP118-500
EGTA Millipore Corporation 32462-25GM
FIJI / Image J https://fiji.sc/ N/A
Frosted Microscope Slides Corning 12-553-10 75mmx25mm, with thickness of 0.9-1.1mm
Glucose Oxidase MP Biomedicals LLC 195196 Type VII, without added oxygen
GMPCPP Jena Biosciences JBS-NU-405S Can be stored for several months at -20 °C and up to a year at -80 °C
Gold Seal-Cover Glass Thermo Scientific 3405
HEPES Fisher Scientific BP310-500
Imidazole Fisher Scientific 03196-500
IPTG Fisher Scientific BP1755-10
Laboratory dessicator Bel-Art 999320237 190mm plate size
Kanamycin Sulfate Fischer Scientific BP906-5
KIF5A K439 (aa:1-439)-6His Gilbert Lab, RPI N/A doi.org/10.1074/jbc.RA118.002182
Kimwipe Kimberley Clark Z188956 lint-free tissue
Immersion Oil, Type B Cargille 16484
Lens Tissue ThorLabs MC-5
LuNA Laser launch (4 channel: 405, 488, 561, 640nm) Nikon N/A
Lysozyme MP Biomedicals LLC 100834
Magnesium Acetate Tetrahydrate Fisher Scientific BP215-500
Microfuge 18 Beckman Coulter 367160
MPEG-SVA MW-5000 Laysan Bio, Inc. NC0107576
Neutravadin Invitrogen PI31000
Nikon Ti-E inverted microscope Nikon N/A Nikon LuN4 Laser
Ni-NTA Resin Thermo Scientific 88221
Oligonucleotide – CACCTATTCTGAGTTTGCGCGA
GAACTTTCAAAGGC		 IDT N/A
Oligonucleotide – GCCTTTGAAAGTTCTCGCGCAA
ACTCAGAATAGGTG		 IDT N/A
Open-top thickwall polycarbonate tube, 0.2 mL, 7 mm x 22 mm Beckman Coulter 343755
Optima-TLX Ultracentrifuge Beckman Coulter 361544
Paclitaxel (Taxol equivalent) Thermo Fisher Scientific P3456
PIPES ACROS Organics 172615000
PMSF Millipore 7110-5GM
Porcine Tubulin, biotin label Cytoskeleton, Inc. T333P
Porcine Tubulin, HiLyte 647 Fluor Cytoskeleton, Inc. TL670M far red labelled
Porcine Tubulin, Rhodamine Cytoskeleton, Inc. TL590M
Porcine Tubulin, Tubulin Protein Cytoskeleton, Inc. T240
Potassium Acetate Fisher Scientific BP364-500
Prime 95B sCMOS camera Photometric N/A
Quadrant Detector Sensor Head ThorLabs PDQ80A
Quikchange Lightning Kit Agilent Technologies 210518
Sodium Bicarbonate Fisher Scientific S233-500
Sodium Phosphate Dibasic Anhydrous Fisher Scientific BP332-500
Square Cover Glasses Corning 12-553-450 18 mm x 18 mm, with thickness of 0.13-0.17 mm
Streptavidin Microspheres Polysciences Inc. 24162-1
Superose-6 Column GE Healthcare 29-0915–96
TCEP Thermo Scientific 77720
TLA-100 Fixed-Angle Rotor Beckman Coulter 343840
Ultrasonic Cleaner (Sonicator) Vevor JPS-08A(DD) 304 stainless steel, 40 kHz frequency, 60 W power
Vectabond APTES solution Vector Laboratories SP-1800-7
Windex Powerized Glass Cleaner with Ammonia-D S.C. Johnson SJN695237
DOWNLOAD MATERIALS LIST

Riferimenti

  1. Bentley, M., Banker, G. The cellular mechanisms that maintain neuronal polarity. Nature Reviews Neuroscience. 17 (10), 611-622 (2016).
  2. Yang, R., et al. A novel strategy to visualize vesicle-bound kinesins reveals the diversity of kinesin-mediated transport. Traffic. 20 (11), 851-866 (2019).
  3. Hirokawa, N., Niwa, S., Tanaka, Y. Molecular motors in neurons: Transport mechanisms and roles in brain function, development, and disease. Neuron. 68 (4), 610-638 (2010).
  4. Helmke, K. J., Heald, R., Wilbur, J. D. Interplay between spindle architecture and function. International Review of Cell and Molecular Biology. 306, (2013).
  5. Elting, M. W., Suresh, P., Dumont, S. The spindle: integrating architecture and mechanics across scales. Trends in Cell Biology. 28 (11), 896-910 (2018).
  6. Kapoor, T. Metaphase spindle assembly. Biologia. 6 (1), 8 (2017).
  7. Svoboda, K., Block, S. M. Force and velocity measured for single kinesin molecules. Cell. 77 (5), 773-784 (1994).
  8. Svoboda, K., Schmidt, C. F., Schnapp, B. J., Block, S. M. Direct observation of kinesin stepping by optical trapping interferometry. Nature. 365 (6448), 721-727 (1993).
  9. Schnitzer, M. J., Visscher, K., Block, S. M. Force production by single kinesin motors. Nature Cell Biology. 2 (10), 718-723 (2000).
  10. Andreasson, J. O. L., Shastry, S., Hancock, W. O., Block, S. M. The mechanochemical cycle of mammalian kinesin-2 KIF3A/B under load. Current Biology. 25 (9), 1166-1175 (2015).
  11. Bensel, B. M. The mechanochemistry of the kinesin-2 kif3ac heterodimer is related to strain-dependent kinetic properties of kif3a and kif3c. Proceedings of the National Academy of Sciences of the United States of America. 117 (27), 15632-15641 (2020).
  12. Gilbert, S. P., Guzik-Lendrun, S., Rayment, I. Kinesin-2 motors: kinetics and biophysics. Journal of Biological Chemistry. 293 (12), 4510-4518 (2018).
  13. Okada, Y., Higuchi, H., Hirokawa, N. Processivity of the single-headed kinesin KIF1A through binding to tubulin. Nature. 424 (6948), 574-577 (2003).
  14. Budaitis, B. G., et al. Pathogenic mutations in the kinesin-3 motor KIF1A diminish force generation and movement through allosteric mechanisms. Journal of Cell Biology. 220 (4), 202004227 (2021).
  15. Tomishige, M., Klopfenstein, D. R., Vale, R. D. Conversion of Unc104/KIF1A kinesin into a processive motor after dimerization. Science. 297 (5590), 2263-2267 (2002).
  16. Siddiqui, N., et al. Force generation of KIF1C is impaired by pathogenic mutations. bioRxiv. , (2021).
  17. Valentine, M. T., Fordyce, P. M., Krzysiak, T. C., Gilbert, S. P., Block, S. M. Individual dimers of the mitotic kinesin motor Eg5 step processively and support substantial loads in vitro. Nature Cell Biology. 8 (5), 470-476 (2006).
  18. Valentine, M. T., Gilbert, S. P. To step or not to step? How biochemistry and mechanics influence processivity in Kinesin and Eg5. Current Opinion in Cell Biology. 19 (1), 75-81 (2007).
  19. Jannasch, A., Bormuth, V., Storch, M., Howard, J., Schäffer, E. Kinesin-8 is a low-force motor protein with a weakly bound slip state. Biophysical Journal. 104 (11), 2456-2464 (2013).
  20. Bormuth, V., Varga, V., Howard, J., Schäffer, E. Protein friction limits diffusive and directed movements of kinesin motors on microtubules. Science. 325 (5942), 870-873 (2009).
  21. Gennerich, A., Carter, A. P., Reck-Peterson, S. L., Vale, R. D. Force-induced bidirectional stepping of cytoplasmic dynein. Cell. 131 (5), 952-965 (2007).
  22. Mallik, R., Carter, B. C., Lex, S. A., King, S. J., Gross, S. P. Cytoplasmic dynein functions as a gear in response to load. Nature. 427 (6975), 649-652 (2004).
  23. Redwine, W. B., et al. The human cytoplasmic dynein interactome reveals novel activators of motility. eLife. 6, 28257 (2017).
  24. Belyy, V., Hendel, N. L., Chien, A., Yildiz, A. Cytoplasmic dynein transports cargos via load-sharing between the heads. Nature Communications. 5 (1), 5544 (2014).
  25. Belyy, V., et al. The mammalian dynein-dynactin complex is a strong opponent to kinesin in a tug-of-war competition. Nature Cell Biology. 18 (9), 1018-1024 (2016).
  26. Subramanian, R., Kapoor, T. M. Building complexity: insights into self-organized assembly of microtubule-based architectures. Developmental Cell. 23 (5), 874-885 (2012).
  27. Forth, S., Kapoor, T. M. The mechanics of microtubule networks in cell division. Journal of Cell Biology. 216 (6), 1525-1531 (2017).
  28. Dumont, S., Mitchison, T. J. Force and length in the mitotic spindle. Current Biology. 19 (17), 749-761 (2009).
  29. McIntosh, J. R., Molodtsov, M. I., Ataullakhanov, F. I. Biophysics of mitosis. Quarterly Reviews of Biophysics. 45 (2), 147-207 (2012).
  30. McIntosh, J., Hays, T. A brief history of research on mitotic mechanisms. Biologia. 5 (4), 55 (2016).
  31. Ferenz, N. P., Gable, A., Wadsworth, P. Mitotic functions of kinesin-5. Seminars in Cell and Developmental Biology. 21 (3), 255-259 (2010).
  32. Kapitein, L. C., et al. The bipolar mitotic kinesin Eg5 moves on both microtubules that it crosslinks. Nature. 435 (7038), 114-118 (2005).
  33. Vukušić, K., Ponjavić, I., Buđa, R., Risteski, P., Tolić, I. M. Microtubule-sliding modules based on kinesins EG5 and PRC1-dependent KIF4A drive human spindle elongation. Developmental Cell. 56 (9), 1253-1267 (2021).
  34. Sturgill, E. G., Ohi, R. Kinesin-12 differentially affects spindle assembly depending on its microtubule substrate. Current Biology. 23 (14), 1280-1290 (2013).
  35. Drechsler, H., McHugh, T., Singleton, M. R., Carter, N. J., McAinsh, A. D. The Kinesin-12 Kif15 is a processive track-switching tetramer. eLife. 3, 01724 (2014).
  36. Tanenbaum, M. E., et al. Kif15 Cooperates with Eg5 to promote bipolar spindle assembly. Current Biology. 19 (20), 1703-1711 (2009).
  37. Mountain, V., et al. Cross-links microtubules in the mammalian mitotic spindle. Journal of Cell Biology. 147 (2), 351-365 (1999).
  38. Norris, S. R., et al. Microtubule minus-end aster organization is driven by processive HSET-tubulin clusters. Nature Communications. 9 (1), 2659 (2018).
  39. Cai, S., Weaver, L. N., Ems-McClung, S. C., Walczak, C. E. Proper organization of microtubule minus ends is needed for midzone stability and cytokinesis. Current Biology. 20 (9), 880-885 (2010).
  40. Pamula, M. C., et al. High-resolution imaging reveals how the spindle midzone impacts chromosome movement. Journal of Cell Biology. 218 (8), 2529-2544 (2019).
  41. Bieling, P., Telley, I. A., Surrey, T. A minimal midzone protein module controls formation and length of antiparallel microtubule overlaps. Cell. 142 (3), 420-432 (2010).
  42. Zhu, C., Lau, E., Schwarzenbacher, R., Bossy-Wetzel, E., Jiang, W. Spatiotemporal control of spindle midzone formation by PRC1 in human cells. Proceedings of the National Academy of Sciences of the United States of America. 103 (16), 6196-6201 (2006).
  43. Subramanian, R., et al. Insights into antiparallel microtubule crosslinking by PRC1, a conserved nonmotor microtubule binding protein. Cell. 142 (3), 433-443 (2010).
  44. Elting, M. W., Prakash, M., Udy, D. B., Dumont, S. Mapping load-bearing in the mammalian spindle reveals local kinetochore fiber anchorage that provides mechanical isolation and redundancy. Current Biology. 27 (14), 2112-2122 (2017).
  45. Fant, X., Merdes, A., Haren, L. Cell and molecular biology of spindle poles and NuMA. International Review of Cytology. 238, 1-57 (2004).
  46. Merdes, A., Heald, R., Samejima, K., Earnshaw, W. C., Cleveland, D. W. Formation of spindle poles by dynein/dynactin-dependent transport of NuMA). Journal of Cell Biology. 149 (4), 851-861 (2000).
  47. Maddox, P., Straight, A., Coughlin, P., Mitchison, T. J., Salmon, E. D. Direct observation of microtubule dynamics at kinetochores in Xenopus extract spindles: Implications for spindle mechanics. Journal of Cell Biology. 162 (3), 377-382 (2003).
  48. Maddox, P., Desai, A., Oegema, K., Mitchison, T. J., Salmon, E. D. Poleward microtubule flux is a major component of spindle dynamics and anaphase A in mitotic Drosophila embryos. Current Biology. 12 (19), 1670-1674 (2002).
  49. LaFountain, J. R., Cohan, C. S., Siegel, A. J., LaFountain, D. J. Direct visualization of microtubule flux during metaphase and anaphase in crane-fly spermatocytes. Molecular Biology of the Cell. 15 (12), 5724-5732 (2004).
  50. Pavin, N., Tolić, I. M. Mechanobiology of the mitotic spindle. Developmental Cell. 56 (2), 192-201 (2021).
  51. Vukušić, K., Tolić, I. M. Anaphase B: Long-standing models meet new concepts. Seminars in Cell and Developmental Biology. 117, 127-139 (2021).
  52. Vukušić, K., et al. Microtubule sliding within the bridging fiber pushes kinetochore fibers apart to segregate chromosomes. Developmental Cell. 43 (1), 11-23 (2017).
  53. Shimamoto, Y., Forth, S., Kapoor, T. M. Measuring pushing and braking forces generated by ensembles of kinesin-5 crosslinking two microtubules. Developmental Cell. 34 (6), 669-681 (2015).
  54. Gaska, I., Armstrong, M. E., Alfieri, A., Forth, S. The mitotic crosslinking protein PRC1 acts like a mechanical dashpot to resist microtubule sliding. Developmental Cell. 54 (3), 367-378 (2020).
  55. Woll, K. A., et al. An allosteric propofol-binding site in kinesin disrupts kinesin-mediated processive movement on microtubules. Journal of Biological Chemistry. 293 (29), 11283-11295 (2018).
  56. Forth, S., Hsia, K. C., Shimamoto, Y., Kapoor, T. M. Asymmetric friction of nonmotor MAPs can lead to their directional motion in active microtubule networks. Cell. 157 (2), 420-432 (2014).
  57. Alfieri, A., Gaska, I., Forth, S. Two modes of PRC1-mediated mechanical resistance to kinesin-driven microtubule network disruption. Current Biology. 31 (12), 2495-2506 (2021).
  58. Koch, M. D., Shaevitz, J. W. Introduction to optical tweezers. Methods in Molecular Biology. 1486, 3-24 (2017).
  59. Sarshar, M., Wong, W. T., Anvari, B. Comparative study of methods to calibrate the stiffness of a single-beam gradient-force optical tweezers over various laser trapping powers. Journal of Biomedical Optics. 19 (11), 115001 (2014).
  60. Van Mameren, J., Wuite, G. J. L., Heller, I. Introduction to optical tweezers: Background, system designs, and commercial solutions. Methods in Molecular Biology. 783, 1-20 (2011).
  61. Bodrug, T., et al. The kinesin-5 tail domain directly modulates the mechanochemical cycle of the motor domain for anti-parallel microtubule sliding. eLife. 9, 51131 (2020).
  62. Reinemann, D. N., et al. Collective force regulation in anti-parallel microtubule gliding by dimeric Kif15 kinesin motors. Current Biology. 27 (18), 2810-2820 (2017).
  63. Reinemann, D. N., Norris, S. R., Ohi, R., Lang, M. J. Processive kinesin-14 HSET exhibits directional flexibility depending on motor traffic. Current Biology:CB. 28 (14), 2356-2362 (2018).
  64. Shimamoto, Y., Forth, S., Kapoor, T. M. Measuring pushing and braking forces generated by ensembles of kinesin-5 crosslinking two microtubules. Developmental Cell. 34 (6), 669-681 (2015).
  65. . SMART – Servier Medical ART Available from: https://smart.servier.com/ (2022)
  66. Gaska, I., Armstrong, M., Alfieri, A., Forth, S. The mitotic crosslinking protein PRC1 acts as a mechanical dashpot to resist microtubule sliding. Developmental Cell. 54 (3), 1-14 (2020).
  67. Janson, M. E., De Dood, M. E., Dogterom, M. Dynamic instability of microtubules is regulated by force. Journal of Cell Biology. 161 (6), 1029-1034 (2003).
  68. Kerssemakers, J. W. J., et al. Assembly dynamics of microtubules at molecular resolution. Nature. 442 (7103), 709-712 (2006).
  69. Powers, A. F., et al. The Ndc80 kinetochore complex forms load-bearing attachments to dynamic microtubule tips via biased diffusion. Cell. 136 (5), 865-875 (2009).
  70. Akiyoshi, B., et al. Tension directly stabilizes reconstituted kinetochore-microtubule attachments. Nature. 468 (7323), 576-579 (2010).
  71. Fong, K. K., et al. Direct measurement of the strength of microtubule attachment to yeast centrosomes. Molecular Biology of the Cell. 28 (14), 1853-1861 (2017).
  72. Kikumoto, M., Kurachi, M., Tosa, V., Tashiro, H. Flexural rigidity of individual microtubules measured by a buckling force with optical traps. Biophysical Journal. 90 (5), 1687-1696 (2006).
  73. Memet, E., et al. Microtubules soften due to cross-sectional flattening. eLife. 7, 34695 (2018).

Tags

Microtubule BundlesCytoskeletal NetworksForce MeasurementOptical TrapTIRF MicroscopySingle-molecule ExperimentsProtein ConcentrationProtein DensityMitosisNeural DevelopmentMuscle ContractionCell MigrationStreptavidinNeutrAvidinCaseinBiotinylated MicrotubulesRhodamine MicrotubulesRigor Kinesin-coated BeadsReaction Buffer
check_url/it/63819?article_type=t

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Citazione di questo articolo
Palumbo, J., Tai, E., Forth, S. Directly Measuring Forces Within Reconstituted Active Microtubule Bundles. J. Vis. Exp. (183), e63819, doi:10.3791/63819 (2022).
Scarica citazione
Ristampe e autorizzazioni

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image