JoVE Journal > Biochemistry
Summary
Abstract
Introduction
Protocol
Risultati
Discussion
Divulgazioni
Acknowledgements
Materials
Riferimenti
Traduzione automatica
Please note that all translations are automatically generated. Click here for the English version.
Biochimica

نشر جزيء واحد وتجميعها على أغشية الدهون المزدحمة بالبوليمر

Published: July 19, 2022
doi:
10.3791/64243
, , , , ,
1Department of Chemical Engineering,Indian Institute of Science, 2Holonyak Micro & Nanotechnology Lab,University of Illinois, Urbana-Champaign, 3Center for BioSystems Science and Engineering,Indian Institute of Science

Summary

هنا ، يتم تقديم بروتوكول لإجراء وتحليل ربط وتنقل وتجميع جزيئات مفردة على أغشية دهنية مزدحمة اصطناعية باستخدام مجهر التألق الداخلي الكلي للانعكاس الداخلي (smTIRF) أحادي الجزيء.

Abstract

الأغشية الخلوية هي بيئات مزدحمة للغاية للتفاعلات الجزيئية الحيوية والإشارات. ومع ذلك ، فإن معظم التجارب في المختبر التي تسبر تفاعل البروتين مع الدهون تستخدم أغشية عارية ثنائية الطبقة. تفتقر هذه الأنظمة إلى تعقيدات الازدحام بالبروتينات والجليكان المدمجة في الغشاء وتستبعد تأثيرات الحجم المرتبطة بها التي تواجهها على أسطح الأغشية الخلوية. أيضا ، فإن السطح الزجاجي المشحون سلبا الذي تتشكل عليه الطبقات الثنائية للدهون يمنع الانتشار الحر للجزيئات الحيوية عبر الغشاء. هنا ، نقدم غشاء بوليمر دهني مميز جيدا كمحاكاة للأغشية الدهنية المزدحمة. يستخدم هذا البروتوكول الدهون المترافقة مع البولي إيثيلين جلايكول (PEG) كنهج عام لدمج الحشود في الطبقة الثنائية الدهنية المدعومة (SLB). أولا ، يتم تقديم إجراء تنظيف للشرائح المجهرية وأغطية الأغطية لإجراء تجارب جزيء واحد. بعد ذلك ، تتم مناقشة طرق توصيف PEG-SLBs وإجراء تجارب جزيء واحد لربط ونشر وتجميع الجزيئات الحيوية باستخدام تتبع جزيء واحد والتبييض الضوئي. وأخيرا، يوضح هذا البروتوكول كيفية مراقبة تجميع المسام النانوية للسم البكتيري المكون للمسام Cytolysin A (ClyA) على الأغشية الدهنية المزدحمة مع تحليل التبييض الضوئي أحادي الجزيء. يتم أيضا تضمين رموز MATLAB مع مجموعات بيانات المثال لإجراء بعض التحليلات الشائعة مثل تتبع الجسيمات واستخراج السلوك المنتشر وعد الوحدات الفرعية.

Introduction

الأغشية الخلوية هي أنظمة مزدحمة للغاية ومعقدة1. يمكن أن يكون للازدحام الجزيئي تأثير كبير على انتشار الكيانات المرتبطة بالغشاء مثل البروتين والدهون2،3،4. وبالمثل ، تتأثر التفاعلات ثنائية الجزيئات على الأغشية الدهنية مثل dimerization المستقبلات أو oligomerization من مجمعات الأغشية بالازدحام5،6،7. يمكن أن تحكم طبيعة وتكوين وتركيز الحشود ربط الغشاء والانتشار والتفاعل بين البروتين والبروتين بعدة طرق 8,9. نظرا لأن التحكم في ازدحام الأغشية على الأغشية الخلوية وتفسير تأثيرها على الجزيئات الحيوية المدمجة يمثل تحديا ، فقد حاول الباحثون إنشاء أنظمة بديلة في المختبر 10.

هناك نهج شائع للأغشية الاصطناعية المزدحمة وهو تخدير الأغشية ثنائية الطبقة بالبوليمر (مثل البولي إيثيلين جلايكول ، PEG) – الدهون المطعمة11,12. أثناء تصور ديناميكيات البروتين والدهون على الطبقات الثنائية للدهون المدعومة (SLBs) ، تحمي هذه البوليمرات بالإضافة إلى ذلك المكونات المضمنة في الغشاء من الركيزة سالبة الشحنة الأساسية (مثل الزجاج) عن طريق رفع الطبقة الثنائية بشكل فعال بعيدا عن الدعم الأساسي. من خلال تغيير حجم وتركيز البوليمر ، يمكن للمرء التحكم في مدى الازدحام الجزيئي ، وكذلك فصله عن الدعم الصلب الأساسي13,14. من الواضح أن هذه ميزة على الطبقات الثنائية الدهنية المدعومة على ركائز صلبة بدون وسائد بوليمر15,16 ، حيث يمكن أن تفقد الجزيئات الحيوية عبر الغشاء نشاطها17,18,19. الأهم من ذلك ، أنه يسمح لنا بتلخيص البيئة المزدحمة لغشاء الخلية في المختبر ، وهو أمر بالغ الأهمية للعديد من عمليات الغشاء.

تخضع البوليمرات المطعمة على السطح على الأغشية أيضا لتغييرات في تكوينها اعتمادا على كثافة التطعيم12. في تركيزات منخفضة ، تبقى في تكوين ملفوف بشكل انتروبي ، يعرف باسم الفطر ، فوق سطح الغشاء. مع زيادة التركيز ، فإنها تبدأ في التفاعل وتميل إلى فك لفائف وتمتد ، مما يؤدي في النهاية إلى تكوين كثيف يشبه الفرشاة على الغشاء21. نظرا لأن الانتقال من الفطر إلى نظام الفرشاة غير متجانس للغاية ويتجلى في ظروف سيئة التمييز للبوليمر ، فمن المهم استخدام ظروف مميزة جيدا للازدحام على الأغشية المطعمة بالبوليمر. بالمقارنة مع دراسة حديثة20 ، فإننا نحدد ونبلغ عن تركيبات الأغشية المزدحمة التي تحافظ على النقل والنشاط المنتشرين للجزيئات الحيوية عبر الغشاء.

في هذا البروتوكول ، نناقش كيفية توليد أغشية دهنية PEGylated ونقدم توصيات لكثافات PEG التي تحاكي الازدحام في نظامين مختلفين من تكوين البوليمر (وهما الفطر والفرشاة). يصف البروتوكول أيضا ربط جزيء واحد ، وتتبع الجسيمات ، والحصول على بيانات التبييض الضوئي وتحليلها للجزيئات المضمنة في هذه الأغشية المزدحمة. أولا ، نصف خطوات التنظيف الشاملة ، وتجميع غرفة التصوير ، وتوليد PEG-SLBs. ثانيا ، نقدم تفاصيل عن ربط جزيء واحد ، وتتبع الجسيمات ، وتجارب التبييض الضوئي. ثالثا ، نناقش i) استخراج تقاربات الارتباط النسبية ، ii) توصيف الانتشار الجزيئي ، و iii) عد الوحدات الفرعية في تجميع البروتين من أفلام جزيئات واحدة على الغشاء.

في حين أننا ميزنا هذا النظام بالتصوير بجزيء واحد ، فإن البروتوكول مفيد لجميع علماء الفيزياء الحيوية في الأغشية المهتمين بفهم تأثير الازدحام على التفاعلات الجزيئية الحيوية على الأغشية الدهنية. بشكل عام ، نقدم خط أنابيب قوي لصنع طبقات ثنائية دهنية مزدحمة ومدعومة ، إلى جانب العديد من اختبارات الجزيء الواحد التي أجريت عليها وإجراءات التحليل المقابلة.

Protocol

1. تنظيف الشريحة والغطاء للتجارب أحادية الجزيء قبل تجميع غرفة التصوير ، قم بتنظيف وإعداد كل من الأغطية والشرائح. قم بحفر أزواج متعددة من الثقوب على الشرائح الزجاجية باستخدام آلة حفر مزودة بتات حفر مغلفة بالماس (قطرها 0.5-1 مم). إذا تم استخدام صفائح الأكريليك ، فاستخدم قاطع ليزر …

Representative Results

مراقبة ارتباط بروتين ClyA على أغشية PEGylatedبعد الخطوة 4.5 ، يتم تقدير حركية الربط عن طريق رسم عدد الجسيمات المرتبطة بسطح الغشاء بمرور الوقت (فيديو 1). عندما يرتبط بروتين ClyA بغشاء يحتوي على 5٪ من دهون PEG2000 مول ، تزداد كثافة الجسيمات وتصل إلى التشبع (الشكل 5). يعطي …

Discussion

هنا ، نعرض تجارب جزيء واحد على الطبقات الثنائية الدهنية المدعومة (SLBs) التي تظهر بيئة مزدحمة للجزيئات الحيوية المضمنة في الغشاء. تولد البيئة المزدحمة تأثير حجم مستبعد ، مما يؤدي إلى تعزيز التفاعلات الجزيئية الحيوية1،2،39،40</…

Divulgazioni

The authors have nothing to disclose.

Acknowledgements

يعترف المؤلفون بالبروفيسور بنيامين شولر لمشاركة تعبير البلازميد لبروتين ClyA. تم دعم هذا العمل من قبل برنامج علوم الحدود البشرية (RGP0047-2020).

Materials

2.5 ml Syringes HMD Healthcare Dispo Van, 2.5 ml Tuberculin Plastic syringe
Acetone Finar Chemicals 10020LL025
Acrylic Sheet 2 mm thick
Acrylic Sheet BigiMall 2 mm, Clear
Bath Sonicator Branson CPX-1800
Calcium Chloride
Chloroform Sigma 528730  HPLC grade
Cholesterol Avanti 700100
Coplin Jar Duran Wheaton Kimble S6016 8 Slide Jar with Glass Cover
Coverslips VWR 631-1574 24 mm X 50 mm
Cy3-DNA Strand IDT GCTGCTATTGCGTCCGTTTGGTT
GGTGTGGTTGG-Cy3
Cyanine Dye (Cy3) Cytiva Life Sciences PA23001
DiI Invitrogen D3911 Dil Stain (1,1'-Dioctadecyl-3,3,3',3'-Tetramethylindocarbocyanine Perchlorate ('DiI'; DiIC18(3)))
DNA Connector Strand 1 Sigma Aldrich GCTGCTATTGCGTCCGTTTAGCT
GGGGGAGTATTGCGGAGGAAGC
T
DNA Connector Strand 2 Sigma Aldrich CGGACGCAATAGCAGCTCACAG
TCGGTCACAT
DNA Tocopherol Strand Biomers Toco-CCCAATGTGACCGACTGTGA
DOPE-PEG2000 Avanti 880130 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (ammonium salt)
Double Sided Tape 3M LF93010LE
Drill Bits (Diamond Coated) 0.5 – 1 mm
Drilling Machine Dremel 220 Workstation
EMCCD Andor DU-897U-CS0-#BV
Fluorescence Beads Invitrogen F10720
Glass Slides Blue Star Micro Slides, PIC-1
Glass Vials Sigma 854190
Hydrogen Peroxide Lobachemie 00182 30% Solution, AR Grade
Labolene Thermo-Fischer Scientific  Detergent
Laser 532 nm Coherent Sapphire
Laser Cutter Universal Laser Systems ILS12.75
Lissamine Rhodamine DOPE Avanti 810150 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(lissamine rhodamine B sulfonyl) (ammonium salt)
Methanol Finar Chemicals 30932LL025
Microscope Olympus IX81
Phosphate Buffer Saline (PBS) 1X
Plasma Cleaner Harrick Plasma Inc PDC-002
POPC Avanti 850457 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine
Programmable Syringe Pump New Era Pump Systems NE1010 High Pressure Syringe Pump
PTFE Caps Sigma 27141
PTFE Tubing Cole-Parmer WW-06417-21 Masterflex, 0.022" ID x 0.042" OD
Sulphuric Acid SD Fine Chemicals 98%, AR Grade
TIRF Objective Olympus UPLAPO100XOHR
Vacuum Desiccator Tarsons
Vortex Mixer Tarsons
DOWNLOAD MATERIALS LIST

Riferimenti

  1. Löwe, M., Kalacheva, M., Boersma, A. J., Kedrov, A. The more the merrier: Effects of macromolecular crowding on the structure and dynamics of biological membranes. The FEBS Journal. 287 (23), 5039-5067 (2020).
  2. Kuznetsova, I. M., Turoverov, K. K., Uversky, V. N. What macromolecular crowding can do to a protein. International Journal of Molecular Sciences. 15 (12), 23090-23140 (2014).
  3. Horton, M. R., Höfling, F., Rädler, J. O., Franosch, T. Development of anomalous diffusion among crowding proteins. Soft Matter. 6 (12), 2648-2656 (2010).
  4. Jeon, J. H., Javanainen, M., Martinez-Seara, H., Metzler, R., Vattulainen, I. Protein crowding in lipid bilayers gives rise to non-Gaussian anomalous lateral diffusion of phospholipids and proteins. Physical Review X. 6 (2), 021006 (2016).
  5. Zhang, Y., et al. The influence of molecular reach and diffusivity on the efficacy of membrane-confined reactions. Biophysical Journal. 117 (7), 1189-1201 (2019).
  6. Loverdo, C., Bénichou, O., Moreau, M., Voituriez, R. Enhanced reaction kinetics in biological cells. Nature Physics. 4 (2), 134-137 (2008).
  7. Monine, M. I., Haugh, J. M. Reactions on cell membranes: Comparison of continuum theory and Brownian dynamics simulations. Journal of Chemical Physics. 123 (7), 074908 (2005).
  8. Berry, H. Anomalous diffusion due to hindering by mobile obstacles undergoing Brownian motion or Orstein-Ulhenbeck processes. Physical Review E. 89 (2), 22708 (2014).
  9. Saxton, M. J. Anomalous diffusion due to obstacles: A Monte Carlo study. Biophysical Journal. 66 (2), 394-401 (1994).
  10. Andersson, J., Fuller, M. A., Wood, K., Holt, S. A., Köper, I. A tethered bilayer lipid membrane that mimics microbial membranes. Physical Chemistry Chemical Physics. 20 (18), 12958-12969 (2018).
  11. Kaufmann, S., Papastavrou, G., Kumar, K., Textor, M., Reimhult, E. A detailed investigation of the formation kinetics and layer structure of poly(ethylene glycol) tether supported lipid bilayers. Soft Matter. 5 (14), 2804-2814 (2009).
  12. Marsh, D., Bartucci, R., Sportelli, L. Lipid membranes with grafted polymers: Physicochemical aspects. Biochimica et Biophysica Acta (BBA) – Biomembranes. 1615 (1-2), 33-59 (2003).
  13. Labouta, H. I., et al. Surface-grafted polyethylene glycol conformation impacts the transport of PEG-functionalized liposomes through a tumour extracellular matrix model. RSC Advances. 8 (14), 7697-7708 (2018).
  14. Lee, H., Larson, R. G. Adsorption of plasma proteins onto PEGylated lipid bilayers: The effect of PEG size and grafting density. Biomacromolecules. 17 (5), 1757-1765 (2016).
  15. Richter, R. P., Bérat, R., Brisson, A. R. Formation of solid-supported lipid bilayers: An integrated view. Langmuir. 22 (8), 3497-3505 (2006).
  16. Andersson, J., et al. Solid-supported lipid bilayers – A versatile tool for the structural and functional characterization of membrane proteins. Methods. 180, 56-68 (2020).
  17. Duncan, A. L., et al. Protein crowding and lipid complexity influence the nanoscale dynamic organization of ion channels in cell membranes. Scientific Reports. 7 (1), 1-15 (2017).
  18. Garenne, D., Libchaber, A., Noireaux, V. Membrane molecular crowding enhances MreB polymerization to shape synthetic cells from spheres to rods. Proceedings of the National Academy of Sciences of the United States of America. 117 (4), 1902-1909 (2020).
  19. Pollock, N. L., Lee, S. C., Patel, J. H., Gulamhussein, A. A., Rothnie, A. J. Structure and function of membrane proteins encapsulated in a polymer-bound lipid bilayer. Biochimica et Biophysica Acta (BBA) – Biomembranes. 1860 (4), 809-817 (2018).
  20. Coker, H. L. E., et al. Controlling anomalous diffusion in lipid membranes. Biophysical Journal. 116 (6), 1085-1094 (2019).
  21. Rex, S., Zuckermann, M. J., Lafleur, M., Silvius, J. R. Experimental and Monte Carlo simulation studies of the thermodynamics of polyethyleneglycol chains grafted to lipid bilayers. Biophysical Journal. 75 (6), 2900-2914 (1998).
  22. Hallett, F. R., Watton, J., Krygsman, P. Vesicle sizing number distributions by dynamic light scattering. Biophysical Journal. 59 (2), 357-362 (1991).
  23. Jin, A. J., Huster, D., Gawrisch, K., Nossal, R. Light scattering characterization of extruded lipid vesicles. European Biophysics Journal. 28 (3), 187-199 (1999).
  24. Axelrod, D. Chapter 7: Total internal reflection fluorescence microscopy. Methods in Cell Biology. 89, 169-221 (2008).
  25. Fish, K. N. Total internal reflection fluorescence (TIRF) microscopy. Current Protocols in Cytometry. 50 (1), 1-13 (2009).
  26. Fiolka, R., Belyaev, Y., Ewers, H., Stemmer, A. Even illumination in total internal reflection fluorescence microscopy using laser light. Microscopy Research and Technique. 71 (1), 45-50 (2008).
  27. Roy, R., Hohng, S., Ha, T. A practical guide to single-molecule FRET. Nature Methods. 5 (6), 507-516 (2008).
  28. Jaqaman, K., et al. Robust single-particle tracking in live-cell time-lapse sequences. Nature Methods. 5 (8), 695-702 (2008).
  29. Tinevez, J. Y., et al. TrackMate: An open and extensible platform for single-particle tracking. Methods. 115, 80-90 (2017).
  30. Jarmoskaite, I., Alsadhan, I., Vaidyanathan, P. P., Herschlag, D. How to measure and evaluate binding affinities. eLife. 9, 57264 (2020).
  31. Sathyanarayana, P., et al. Cholesterol promotes Cytolysin A activity by stabilizing the intermediates during pore formation. Proceedings of the National Academy of Sciences of the United States of America. 115 (31), 7323-7330 (2018).
  32. Mueller, M., Grauschopf, U., Maier, T., Glockshuber, R., Ban, N. The structure of a cytolytic alpha-helical toxin pore reveals its assembly mechanism. Nature. 459 (7247), 726-730 (2009).
  33. Hubicka, K., Janczura, J. Time-dependent classification of protein diffusion types: A statistical detection of mean-squared-displacement exponent transitions. Physical Review E. 101 (2), 1-13 (2020).
  34. Kepten, E., Weron, A., Sikora, G., Burnecki, K., Garini, Y. Guidelines for the fitting of anomalous diffusion mean square displacement graphs from single particle tracking experiments. PLoS ONE. 10 (2), 0117722 (2015).
  35. Persson, F., Lindén, M., Unoson, C., Elf, J. Extracting intracellular diffusive states and transition rates from single-molecule tracking data. Nature Methods. 10 (3), 265-269 (2013).
  36. McGuire, H., Aurousseau, M. R. P., Bowie, D., Blunck, R. Automating single subunit counting of membrane proteins in mammalian cells. The Journal of Biological Chemistry. 287 (43), 35912-35921 (2012).
  37. Hines, K. E. Inferring subunit stoichiometry from single molecule photobleaching. The Journal of General Physiology. 141 (6), 737-746 (2013).
  38. Zhang, H., Guo, P. Single molecule photobleaching (SMPB) technology for counting of RNA, DNA, protein and other molecules in nanoparticles and biological complexes by TIRF instrumentation. Methods. 67 (2), 169-176 (2014).
  39. Phillip, Y., Schreiber, G. Formation of protein complexes in crowded environments-From in vitro to in vivo. FEBS Letters. 587 (8), 1046-1052 (2013).
  40. Mittal, S., Chowhan, R. K., Singh, L. R. Macromolecular crowding: Macromolecules friend or foe. Biochimica et Biophysica Acta – General Subjects. 1850 (9), 1822-1831 (2015).
  41. Mashaghi, S., van Oijen, A. M. A versatile approach to the generation of fluid supported lipid bilayers and its applications. Biotechnology and Bioengineering. 111 (10), 2076-2081 (2014).
  42. Wong, W. C., et al. Characterization of single-protein dynamics in polymer-cushioned lipid bilayers derived from cell plasma membranes. The Journal of Physical Chemistry B. 123 (30), 6492-6504 (2019).
  43. Shashkova, S. S., Leake, M. C. Single-molecule fluorescence microscopy review: Shedding new light on old problems. Bioscience Reports. 37 (4), 20170031 (2017).
  44. Ishikawa-Ankerhold, H. C., Ankerhold, R., Drummen, G. P. C. Advanced fluorescence microscopy techniques-FRAP, FLIP, FLAP, FRET and FLIM. Molecules. 17 (4), 4047 (2012).
  45. Aitken, C. E., Marshall, R. A., Puglisi, J. D. An oxygen scavenging system for improvement of dye stability in single-molecule fluorescence experiments. Biophysical Journal. 94 (5), 1826-1835 (2008).
  46. Carter, B. C., Vershinin, M., Gross, S. P. A comparison of step-detection methods: How well can you do. Biophysical Journal. 94 (1), 306-319 (2008).
  47. Otsuka, S., Ellenberg, J. Mechanisms of nuclear pore complex assembly – Two different ways of building one molecular machine. FEBS Letters. 592 (4), 475 (2018).
  48. Tsekouras, K., Custer, T. C., Jashnsaz, H., Walter, N. G., Pressé, S. A novel method to accurately locate and count large numbers of steps by photobleaching. Molecular Biology of the Cell. 27 (22), 3601-3615 (2016).
  49. Bryan, J. S., Sgouralis, I., Pressé, S. Enumerating high numbers of fluorophores from photobleaching experiments: A Bayesian nonparametrics approach. bioRxiv. , (2020).
  50. Bryan, J. S., Sgouralis, I., Pressé, S. Diffraction-limited molecular cluster quantification with Bayesian nonparametrics. Nature Computational Science. 2 (2), 102-111 (2022).
  51. Kim, Y., et al. Efficient site-specific labeling of proteins via cysteines. Bioconjugate Chemistry. 19 (3), 786-791 (2008).

Tags

Single-molecule ImagingPolymer-crowded Lipid MembranesSupported Lipid BilayersMembrane Biomolecular ReactionsDiffusionAssemblyPOPCDOPE-PEG(2000)Small Unilamellar VesiclesSonicationMicrofluidic Imaging Chambers
check_url/it/64243?article_type=t&slug=single-molecule-diffusion-assembly-on-polymer-crowded-lipid

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Citazione di questo articolo
Maurya, S., Rai, V. H., Upasani, A., Umrao, S., Parwana, D., Roy, R. Single-Molecule Diffusion and Assembly on Polymer-Crowded Lipid Membranes. J. Vis. Exp. (185), e64243, doi:10.3791/64243 (2022).
Scarica citazione
Ristampe e autorizzazioni

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image