JoVE Journal > Biology
Summary
Abstract
Introduction
Protocol
Risultati
Discussion
Divulgazioni
Acknowledgements
Materials
Riferimenti
Traduzione automatica
Please note that all translations are automatically generated. Click here for the English version.
Biologia

Het vaststellen van 3D-endometriumorganoïden uit de baarmoeder van de muis

Published: January 06, 2023
doi:
10.3791/64448
, , , , ,
1Department of Pathology & Immunology,Baylor College of Medicine, 2Center for Drug Discovery,Baylor College of Medicine, 3Departments of Molecular Virology and Microbiology and Medicine,Baylor College of Medicine

Summary

Dit protocol beschrijft methodologieën om endometriumepitheelorganoïden van muizen vast te stellen voor genexpressie en histologische analyses.

Abstract

Endometriumweefsel bekleedt de binnenholte van de baarmoeder en staat onder de cyclische controle van oestrogeen en progesteron. Het is een weefsel dat is samengesteld uit luminaal en klierepitheel, een stromaal compartiment, een vasculair netwerk en een complexe immuuncelpopulatie. Muismodellen zijn een krachtig hulpmiddel geweest om het baarmoederslijmvlies te bestuderen en onthullen kritieke mechanismen die implantatie, placentatie en kanker beheersen. De recente ontwikkeling van 3D-endometriumorganoïde culturen presenteert een state-of-the-art model om de signaalroutes te ontleden die ten grondslag liggen aan endometriumbiologie. Het vaststellen van endometriumorganoïden uit genetisch gemanipuleerde muismodellen, het analyseren van hun transcriptomen en het visualiseren van hun morfologie met een resolutie van één cel zijn cruciale hulpmiddelen voor de studie van endometriumziekten. Dit artikel schetst methoden om 3D-culturen van endometriumepitheel van muizen vast te stellen en beschrijft technieken om genexpressie te kwantificeren en de histologie van de organoïden te analyseren. Het doel is om een bron te bieden die kan worden gebruikt om de genexpressie en morfologische kenmerken van endometriumepitheelorganoïden vast te stellen, te kweken en te bestuderen.

Introduction

Het endometrium – het binnenste bekledingsslijmvliesweefsel van de baarmoederholte – is een uniek en zeer dynamisch weefsel dat een cruciale rol speelt in de reproductieve gezondheid van een vrouw. Tijdens de reproductieve levensduur heeft het endometrium het potentieel om honderden cycli van proliferatie, differentiatie en afbraak te ondergaan, gecoördineerd door de gecoördineerde werking van de eierstokhormonen – oestrogeen en progesteron. Studies van genetisch gemanipuleerde muizen hebben fundamentele biologische mechanismen blootgelegd die de endometriumrespons op hormonen en de controle van embryo-implantatie, stromale celdecidualisatie en zwangerschap ondersteunen1. In vitro studies zijn echter beperkt geweest vanwege problemen bij het handhaven van niet-getransformeerde primaire endometriumweefsels van muizen in traditionele 2D-celculturen 2,3. Recente ontwikkelingen in de cultuur van endometriumweefsels als 3D-orgaansystemen, of organoïden, bieden een nieuwe kans om biologische routes te onderzoeken die de regeneratie en differentiatie van endometriumcellen regelen. Muis- en humaan endometriumorganoïde systemen zijn ontwikkeld uit zuiver endometriumepitheel ingekapseld in verschillende matrices 4,5, terwijl menselijk endometrium is gekweekt als steigervrije epitheliale / stromale co-culturen 6,7, en meer recent als collageen-ingekapselde epitheliale / stromale assembloïden8 . De groei en het regeneratieve potentieel van epitheliale organoïde culturen wordt ondersteund door een gedefinieerde cocktail van groeifactoren en kleine molecuulremmers die empirisch zijn vastgesteld om de groei en regeneratie van de organoïden te maximaliseren 4,5,9. Bovendien maakt het vermogen om endometriumorganoïden te bevriezen en te ontdooien het langdurig bankieren van endometriumorganoïden van muizen en mensen mogelijk voor toekomstige studies.

Genetisch gemanipuleerde muizen hebben de complexe signaalroutes onthuld die de vroege zwangerschap en decidualisatie regelen, en zijn gebruikt als modellen van zwangerschapsverlies, endometriumkanker en endometriose. Deze genetische studies zijn grotendeels bereikt met celspecifieke deletie van loxP geflankeerde allelen (“floxed”) met behulp van cre-recombinasen die specifiek actief zijn in vrouwelijke voortplantingsweefsels. Deze muismodellen omvatten de veelgebruikte progesteronreceptor-cre10, die een sterke recombinase-activiteit heeft in de endometriumepitheel- en stromale weefsels, lactoferrine i-cre, dat endometriumepitheelrecombinatie induceert bij volwassen muizen11, of Wnt7a-cre, dat epitheliale-specifieke deletie veroorzaakt in van Müller afgeleide weefsels12 . Het kweken van endometriumweefsels uit genetisch gemanipuleerde muismodellen als 3D-organoïden heeft een uitstekende gelegenheid geboden om endometriumbiologie te onderzoeken en de identificatie van groeifactoren en signaalroutes te vergemakkelijken die de vernieuwing en differentiatie van endometriumcellen regelen13,14. Methoden voor de isolatie en kweek van muizenslijmbeenweefsel worden beschreven in de literatuur en rapporteren het gebruik van verschillende enzymatische strategieën voor de isolatie van baarmoederepitheel voor het daaropvolgende kweken van endometriumepitheelorganoïden4. Terwijl eerdere literatuur een kritisch kader biedt voor endometriumepitheel organoïde cultuurprotocollen 4,5,6, biedt dit artikel een duidelijke, uitgebreide methode voor het genereren, onderhouden, verwerken en analyseren van deze organoïden. Standaardisatie van deze technieken is belangrijk voor het versnellen van de vooruitgang op het gebied van reproductieve biologie van vrouwen. Hier rapporteren we een gedetailleerde methodologie voor de enzymatische en mechanische zuivering van endometriumepitheelweefsel van muizen voor de daaropvolgende kweek van endometriumorganoïden in een gelmatrixsteiger. We beschrijven ook de methodologieën voor downstream histologische en moleculaire analyses van de gelmatrix-ingekapselde muis endometriumepitheel organoïden.

Protocol

Muisbehandeling en experimentele studies werden uitgevoerd onder protocollen die zijn goedgekeurd door de Institutional Animal Care and Use Committee (IACUC) van Baylor College of Medicine en richtlijnen die zijn vastgesteld door de NIH Guide for the Care and Use of Laboratory Animals. 1. Isolatie van baarmoederepitheel van muizen met behulp van enzymatische en mechanische methoden OPMERKING: In dit gedeelte worden de stappen beschreven die nodig zijn…

Representative Results

Fasecontrastbeelden van endometriumorganoïden van muizenWe hebben organoïden vastgesteld uit WT-muizenendometriumepitheel, zoals beschreven in het bijgevoegde protocol (zie diagram in figuur 1). Na enzymatische dissociatie van het endometriumepitheel van de muis werden epitheliale vellen mechanisch gescheiden van de stromale cellen van de baarmoeder en verder gedissocieerd met collagenase om een eencellige suspensie te genereren. Indien correct uitgevoerd, zou deze met…

Discussion

Hier beschrijven we methoden om endometriumepitheelorganoïden te genereren uit muizenslijmvlies en de protocollen die routinematig worden gebruikt voor hun downstream-analyse. Endometriumorganoïden zijn een krachtig hulpmiddel om de mechanismen te bestuderen die endometriumgerelateerde ziekten beheersen, zoals endometriose, endometriumkanker en implantatiefalen. Baanbrekende studies gepubliceerd in 2017 rapporteerden de omstandigheden om langdurige en hernieuwbare culturen van endometriumorganoïden uit muis en humaan …

Divulgazioni

The authors have nothing to disclose.

Acknowledgements

We bedanken Dr. Stephanie Pangas en Dr. Martin M. Matzuk (M.M.M.) voor het kritisch lezen en redigeren van ons manuscript. Studies werden ondersteund door Eunice Kennedy Shriver National Institute of Child Health and Human Development subsidies R00-HD096057 (D.M.), R01-HD105800 (D.M.), R01-HD032067 (M.M.M.) en R01-HD110038 (M.M.), en door NCI- P30 Cancer Center Support Grant (NCI-CA125123). Diana Monsivais, Ph.D. heeft een Next Gen Pregnancy Award van het Burroughs Wellcome Fund.

Materials

Organoid Media Formulation
Name Company Catalog Number Final concentration
Corning Matrigel Growth Factor Reduced (GFR) Basement Membrane Matrix, *LDEV-free Corning 354230 100%
Trypsin from Bovine Pancreas Sigma Aldrich T1426-1G 1%
Advanced DMEM/F12 Life Technologies 12634010 1X
N2 supplement Life Technologies 17502048 1X
B-27™ Supplement (50X), minus vitamin A Life Technologies 12587010 1X
Primocin Invivogen ant-pm-1 100 µg/mL
N-Acetyl-L-cysteine Sigma Aldrich A9165-5G 1.25 mM
L-glutamine Life Technologies 25030024 2 mM
Nicotinamide Sigma Aldrich N0636-100G 10 nM
ALK-4, -5, -7 inhibitor, A83-01 Tocris 2939 500 nM
Recombinant human EGF Peprotech AF-100-15 50 ng/mL
Recombinant human Noggin Peprotech 120-10C 100 ng/mL
Recombinant human Rspondin-1 Peprotech 120-38 500 ng/mL
Recombinant human FGF-10 Peprotech 100-26 100 ng/mL
Recombinant human HGF Peprotech 100-39 50 ng/mL
WNT3a R&D systems 5036-WN 200 ng/mL
Other supplies and reagents
Name Company Catalog Number Final concentration
Collagenase from Clostridium histolyticum Sigma Aldrich C0130-1G 5 mg/mL
Deoxyribonuclease I from bovine pancreas Sigma Aldrich DN25-100MG 2 mg/mL
DPBS, no calcium, no magnesium ThermoFisher 14190-250 1X
HBSS, no calcium, no magnesium ThermoFisher 14170112 1X
Falcon Polystyrene Microplates (24-Well) Fisher Scientific #08-772-51
Falcon Polystyrene Microplates (12-Well) Fisher Scientific #0877229
Falcon Cell Strainers, 40 µm Fisher Scientific #08-771-1
Direct-zol RNA MiniPrep (50 µg) Genesee Scientific 11-331
Trizol reagent Invitrogen 15596026
DMEM/F-12, HEPES, no phenol red ThermoFisher 11039021
Fetal Bovine Serum, Charcoal stripped Sigma Aldrich F6765-500ML 2%
Estratiol (E2) Sigma Aldrich E1024-1G 10 nM
Formaldehyde 16% in aqueous solution, EM Grade VWR 15710 4%
Epredia Cassette 1 Slotted Tissue Cassettes Fisher Scientific 1000961
Epredia Stainless-Steel Embedding Base Molds Fisher Scientific 64-010-15 
Ethanol, 200 proof (100%) Fisher Scientific 22-032-601 
Histoclear Fisher Scientific 50-899-90147
Permount Mounting Medium Fisher Scientific 50-277-97
Epredia Nylon Biopsy Bags Fisher Scientific 6774010
HistoGel Specimen Processing Gel VWR 83009-992
Hematoxylin solution Premium VWR 95057-844
Eosin Y (yellowish) solution Premium VWR 95057-848
TBS Buffer, 20X, pH 7.4 GenDEPORT T8054 1X
TBST (10X), pH 7.4 GenDEPORT T8056 1X
Citric acid  Sigma Aldrich C0759-1KG
Sodium citrate tribasic dihydrate Sigma Aldrich S4641-500G
Tween20 Fisher Scientific BP337-500 
Bovine Serum Albumin (BSA) Sigma Aldrich A2153-100G 3%
DAPI Solution (1 mg/mL) ThermoFisher 62248 1:1000 dilution
VECTASHIELD Antifade Mounting Medium Vector Labs H-1000-10
Clear Nail Polish Fisher Scientific NC1849418
Fisherbrand Superfrost Plus Microscope Slides Fisher Scientific 22037246
VWR Micro Cover Glasses VWR 48393-106
SuperScript VILO Master Mix ThermoFisher 11755050
SYBR Green PCR Master Mix ThermoFisher 4364346
Krt8 Antibody (TROMA-I)  DSHB TROMA-I  1:50 dilution
Vimentin Antobody Cell Signaling 5741S 1:200 dilution
Donkey anti-Rat IgG (H+L) Highly Cross-Adsorbed Secondary
Antibody, Alexa Fluor 594		 ThermoFisher A-21209 1:250 dilution
Donkey anti-Rabbin IgG (H+L) Highly Cross-Adsorbed Secondary
Antibody, Alexa Fluor 488		 ThermoFisher A-21206 1:250 dilution
ZEISS Stemi 508 Stereo Microscope ZEISS
ZEISS Axio Vert.A1 Inverted Routine Microscope with digital camera ZEISS
Primer Sequence Forward (5'-3') Reverse (5'-3') _
Lipocalin 2 (Lcn2) GCAGGTGGTACGTTGTGGG CTCTTGTAGCTCATAGATGGTGC
Lactoferrin (Ltf) TGAGGCCCTTGGACTCTGT ACCCACTTTTCTCATCTCGTTC
Progesterone (Pgr) CCCACAGGAGTTTGTCAAGCTC TAACTTCAGACATCATTTCCGG
Glyceraldehyde 3 phosphate dehydrogenase (Gapdh) CAATGTGTCCGTCGTGGATCT GCCTGCTTCACCACCTTCTT
DOWNLOAD MATERIALS LIST

Riferimenti

  1. Wang, H., Dey, S. K. Roadmap to embryo implantation: clues from mouse models. Nature Reviews Genetics. 7 (3), 185-199 (2006).
  2. Hibaoui, Y., Feki, A. Organoid models of human endometrial development and disease. Frontiers in Cell and Developmental Biology. 8, 84 (2020).
  3. Rawlings, T. M., Makwana, K., Tryfonos, M., Lucas, E. S. Organoids to model the endometrium: implantation and beyond. Reproduction & Fertility. 2 (3), 85-101 (2021).
  4. Boretto, M., et al. Development of organoids from mouse and human endometrium showing endometrial epithelium physiology and long-term expandability. Development. 144 (10), 1775-1786 (2017).
  5. Turco, M. Y., et al. Long-term, hormone-responsive organoid cultures of human endometrium in a chemically defined medium. Nature Cell Biology. 19 (5), 568-577 (2017).
  6. Murphy, A. R., Wiwatpanit, T., Lu, Z., Davaadelger, B., Kim, J. J. Generation of multicellular human primary endometrial organoids. Journal of Visualized Experiments. (152), e60384 (2019).
  7. Wiwatpanit, T., et al. Scaffold-free endometrial organoids respond to excess androgens associated with polycystic ovarian syndrome. The Journal of Clinical Endocrinology and Metabolism. 105 (3), 769-780 (2020).
  8. Rawlings, T. M., et al. Modelling the impact of decidual senescence on embryo implantation in human endometrial assembloids. Elife. 10, 69603 (2021).
  9. Lou, L., Kong, S., Sun, Y., Zhang, Z., Wang, H. Human endometrial organoids: recent research progress and potential applications. Frontiers in Cell and Developmental Biology. 10, 844623 (2022).
  10. Soyal, S. M., et al. Cre-mediated recombination in cell lineages that express the progesterone receptor. Genesis. 41 (2), 58-66 (2005).
  11. Daikoku, T., et al. Lactoferrin-iCre: a new mouse line to study uterine epithelial gene function. Endocrinology. 155 (7), 2718-2724 (2014).
  12. Winuthayanon, W., Hewitt, S. C., Orvis, G. D., Behringer, R. R., Korach, K. S. Uterine epithelial estrogen receptor alpha is dispensable for proliferation but essential for complete biological and biochemical responses. Proceedings of the National Academy of Sciences. 107 (45), 19272-19277 (2010).
  13. Seishima, R., et al. Neonatal Wnt-dependent Lgr5 positive stem cells are essential for uterine gland development. Nature Communications. 10 (1), 5378 (2019).
  14. Syed, S. M., et al. Endometrial Axin2(+) cells drive epithelial homeostasis, regeneration, and cancer following oncogenic transformation. Cell Stem Cell. 26 (1), 64-80 (2020).
  15. Caligioni, C. S. Assessing reproductive status/stages in mice. Current Protocols in Neuroscience. , (2009).
  16. Fitzgerald, H. C., Schust, D. J., Spencer, T. E. In vitro models of the human endometrium: evolution and application for women’s health. Biology of Reproduction. 104 (2), 282-293 (2021).
  17. Hewitt, S. C., et al. Progesterone signaling in endometrial epithelial organoids. Cells. 11 (11), 1760 (2022).
  18. Sadeghipour, A., Babaheidarian, P. Making formalin-fixed, paraffin embedded blocks. Methods in Molecular Biology. 1897, 253-268 (2019).
  19. Qin, C., et al. The cutting and floating method for paraffin-embedded tissue for sectioning. Journal of Visualized Experiments. (139), e58288 (2018).
  20. Rekhtman, N., et al. Novel modification of HistoGel-based cell block preparation method: improved sufficiency for molecular studies. Archives of Pathology & Laboratory Medicine. 142 (4), 529-535 (2018).
  21. Shidham, V. B. CellBlockistry: Chemistry and art of cell-block making – A detailed review of various historical options with recent advances. Cytojournal. 16, 12 (2019).
  22. Ali, A., Syed, S. M., Tanwar, P. S. Protocol for in vitro establishment and long-term culture of mouse vaginal organoids. STAR Protocols. 1 (2), 100088 (2020).
  23. Kurihara, I., et al. COUP-TFII mediates progesterone regulation of uterine implantation by controlling ER activity. PLoS Genet. 3 (6), 102 (2007).
  24. McMaster, M. T., Teng, C. T., Dey, S. K., Andrews, G. K. Lactoferrin in the mouse uterus: analyses of the preimplantation period and regulation by ovarian steroids. Molecular Endocrinology. 6 (1), 101-111 (1992).
  25. Huang, H. L., Chu, S. T., Chen, Y. H. Ovarian steroids regulate 24p3 expression in mouse uterus during the natural estrous cycle and the preimplantation period. The Journal of Endocrinology. 162 (1), 11-19 (1999).
  26. Clevers, H. Modeling development and disease with organoids. Cell. 165 (7), 1586-1597 (2016).
  27. Bigsby, R. M., Cunha, G. R. Estrogen stimulation of deoxyribonucleic acid synthesis in uterine epithelial cells which lack estrogen receptors. Endocrinology. 119 (1), 390-396 (1986).
  28. Clementi, C., et al. Activin-like kinase 2 functions in peri-implantation uterine signaling in mice and humans. PLoS Genetics. 9 (11), 1003863 (2013).
  29. Jeong, J. W., et al. Foxa2 is essential for mouse endometrial gland development and fertility. Biology of Reproduction. 83 (3), 396-403 (2010).
  30. Song, Y., et al. Endometriotic organoids: a novel in vitro model of endometriotic lesion development. bioRxiv. , (2022).
  31. Miyazaki, K., et al. Generation of progesterone-responsive endometrial stromal fibroblasts from human induced pluripotent stem cells: role of the WNT/CTNNB1 pathway. Stem Cell Reports. 11 (5), 1136-1155 (2018).
  32. Yoshimatsu, S., Kisu, I., Qian, E., Noce, T. A new horizon in reproductive research with pluripotent stem cells: successful in vitro gametogenesis in rodents, its application to large animals, and future in vitro reconstitution of reproductive organs such as "Uteroid" and "Oviductoid&#34. Biologia. 11 (7), 987 (2022).
  33. Cheung, V. C., et al. Pluripotent stem cell-derived endometrial stromal fibroblasts in a cyclic, hormone-responsive, coculture model of human decidua. Cell Reports. 35 (7), 109138 (2021).
  34. McGowen, M. R., Erez, O., Romero, R., Wildman, D. E. The evolution of embryo implantation. The International Journal of Development Biology. 58 (2-4), 155-161 (2014).
  35. Carson, D. D., et al. Embryo implantation. Biologia dello sviluppo. 223 (2), 217-237 (2000).
  36. Li, Y., Sun, X., Dey, S. K. Entosis allows timely elimination of the luminal epithelial barrier for embryo implantation. Cell Reports. 11 (3), 358-365 (2015).
  37. Jain, V., Chodankar, R. R., Maybin, J. A., Critchley, H. O. D. Uterine bleeding: how understanding endometrial physiology underpins menstrual health. Nature Reviews Endocrinology. 18 (5), 290-308 (2022).
  38. Hayashi, K., et al. Wnt genes in the mouse uterus: potential regulation of implantation. Biology of Reproduction. 80 (5), 989-1000 (2009).
  39. Dunlap, K. A., et al. Postnatal deletion of Wnt7a inhibits uterine gland morphogenesis and compromises adult fertility in mice. Biology of Reproduction. 85 (2), 386-396 (2011).
  40. Ter Steege, E. J., Bakker, E. R. M. The role of R-spondin proteins in cancer biology. Oncogene. 40 (47), 6469-6478 (2021).
  41. Brazil, D. P., Church, R. H., Surae, S., Godson, C., Martin, F. BMP signalling: agony and antagony in the family. Trends in Cell Biology. 25 (5), 249-264 (2015).
  42. Tojo, M., et al. The ALK-5 inhibitor A-83-01 inhibits Smad signaling and epithelial-to-mesenchymal transition by transforming growth factor-beta. Cancer Science. 96 (11), 791-800 (2005).
  43. Zhang, Y., Que, J. BMP signaling in development, stem cells, and diseases of the gastrointestinal tract. Annual Review of Physiology. 82, 251-273 (2020).
  44. Plikus, M. V., et al. Cyclic dermal BMP signalling regulates stem cell activation during hair regeneration. Nature. 451 (7176), 340-344 (2008).
  45. Gurung, S., Werkmeister, J. A., Gargett, C. E. Inhibition of transforming growth factor-β receptor signaling promotes culture expansion of undifferentiated human endometrial mesenchymal stem/stromal cells. Scientific Reports. 5, 15042 (2015).
  46. Lucciola, R., et al. Impact of sustained transforming growth factor-β receptor inhibition on chromatin accessibility and gene expression in cultured human endometrial MSC. Frontiers in Cell and Developmental Biology. 8, 567610 (2020).
  47. Hernandez-Gordillo, V., et al. Fully synthetic matrices for in vitro culture of primary human intestinal enteroids and endometrial organoids. Biomaterials. 254, 120125 (2020).
  48. Gnecco, J. S., et al. Physiomimetic Models of Adenomyosis. Seminars in Reproductive Medicine. 38 (2-03), 179-196 (2020).
  49. Nikolakopoulou, K., Turco, M. Y. Investigation of infertility using endometrial organoids. Reproduction. 161 (5), 113-127 (2021).
  50. Kim, J. J. Preparing for implantation. Elife. 10, 73739 (2021).

Tags

3D Endometrial OrganoidsMouse UterusUterine EpitheliumEnzymatic DissociationMechanical DissociationCell CultureOrganoid EstablishmentCell PelletCollagenaseDNA Solution
check_url/it/64448?article_type=t

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Citazione di questo articolo
Tang, S., Parks, S. E., Liao, Z., Cope, D. I., Blutt, S. E., Monsivais, D. Establishing 3D Endometrial Organoids from the Mouse Uterus. J. Vis. Exp. (191), e64448, doi:10.3791/64448 (2023).
Scarica citazione
Ristampe e autorizzazioni

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image