מיקרו-הזרקה של רטרו-וירוס רקומביננטי RCAS(A) לעדשת עוף עוברית
Summary
מאמר פרוטוקול זה מתאר את המתודולוגיה של מיקרו-הזרקה של רטרו-וירוס RCAS(A) בעדשת עוף עוברית ככלי לחקר תפקוד באתרו וביטוי חלבונים במהלך התפתחות העדשה.
Abstract
עוף עוברי (Gallus domesticus) הוא מודל חייתי מבוסס היטב לחקר התפתחות העדשה והפיזיולוגיה, בהתחשב במידת הדמיון הגבוהה שלה לעדשה האנושית. RCAS(A) הוא רטרו-וירוס עוף בעל יכולת שכפול המדביק תאים מתחלקים, המשמש ככלי רב עוצמה לחקר הביטוי באתרו ותפקודם של חלבונים מסוג בר וחלבונים מוטנטיים במהלך התפתחות העדשה על ידי מיקרו-הזרקה ללומן הריק של שלפוחית העדשה בשלבי התפתחות מוקדמים, ומגביל את פעולתו לתאי עדשה מתרבים סביב. בהשוואה לגישות אחרות, כגון מודלים טרנסגניים ותרביות ex vivo, השימוש ברטרו-וירוס עופות בעל יכולת שכפול RCAS(A) מספק מערכת יעילה, מהירה וניתנת להתאמה אישית לביטוי חלבונים אקסוגניים בעוברי אפרוחים. באופן ספציפי, העברת גנים ממוקדת יכולה להיות מוגבלת לתאי סיבי עדשה מתרבים ללא צורך במקדמים ספציפיים לרקמות. במאמר זה, נסקור בקצרה את השלבים הדרושים להכנת רטרו-וירוס רקומביננטי RCAS(A), נספק סקירה מפורטת ומקיפה של הליך המיקרו-הזרקה, ונספק תוצאות לדוגמה של הטכניקה.
Introduction
מטרת פרוטוקול זה היא לתאר את המתודולוגיה של מיקרו-הזרקה של עדשת עוף עוברית של RCAS(A) (סרקומה של עופות / רטרו-וירוס לויקוזיס A). העברה רטרו-ויראלית יעילה בעדשת עוף עוברית הוכחה ככלי מבטיח לחקר in vivo של המנגנון המולקולרי והמבנה-תפקוד של חלבוני עדשה בפיזיולוגיה רגילה של העדשה, בתנאים פתולוגיים ובהתפתחות. יתר על כן, מודל ניסיוני זה יכול לשמש לזיהוי מטרות טיפוליות וסינון תרופות למצבים כגון קטרקט מולד אנושי. בסך הכל, פרוטוקול זה נועד לפרוס את הצעדים הדרושים לפיתוח פלטפורמה להתאמה אישית לחקר חלבוני עדשה.
אפרוחים עובריים (Gallus domesticus), בשל הדמיון שלהם במבנה העדשה ובתפקודה עם העדשה האנושית, הם מודל חייתי מבוסס היטב לחקר התפתחות העדשה ופיזיולוגיה 1,2,3,4. השימוש ברטרו-וירוס עופות RCAS(A) בעל יכולת שכפול נחשב למערכת יעילה, מהירה וניתנת להתאמה אישית לביטוי חלבונים אקסוגניים בעוברי אפרוחים. יש לציין כי יש לו יכולת ייחודית להגביל את העברת גן המטרה לתאי סיבי עדשה שגשוגיים ללא צורך במקדמים ספציפיים לרקמות, תוך שימוש במסגרת הזמן הייחודית להתפתחות עוברית שבה נוכחות לומן עדשה ריק מאפשרת באתרו מיקרו-הזרקה RCAS(A) לאתר המוגבל לביטוי חלבונים אקסוגניים בתוך תאי סיבי עדשה מתרבים5, 6,7,8.
הליך המיקרו-הזרקה של עובר אפרוח, המתואר כאן בהרחבה, מבוסס בחלקו על עבודתו של Fekete et. al.6 ופותח עוד יותר על ידי Jiang et. al.8 ושימש כאמצעי להחדרת פלסמידים נגיפיים ולא ויראליים לעדשת אפרוחים עובריים 1,9,10,11,12,13. בסך הכל, העבודה הקודמת מדגימה את הפוטנציאל של שימוש במתודולוגיה זו לחקר התפתחות עדשות, התמיינות שלהן, תקשורת תאית והתקדמות מחלות, ולגילוי ובדיקה של מטרות טיפוליות למצבים פתולוגיים של עדשות כגון קטרקט.
Protocol
Representative Results
Discussion
מודל ניסיוני זה מציע הזדמנות לבטא את העניין של החלבונים בעדשה השלמה, מה שמוביל לחקר הרלוונטיות התפקודית של חלבונים אלה במבנה העדשה ובתפקודה. מודל המיקרו-הזרקה של אפרוח עוברי מבוסס בחלקו על עבודתו של Fekete et. al.6 ופותח עוד יותר על ידי Jiang et. al.8 ושימש כאמצעי להחדרת פלסמ?…
Divulgazioni
The authors have nothing to disclose.
Acknowledgements
עבודה זו נתמכה על ידי מענקי המכונים הלאומיים לבריאות (NIH): RO1 EY012085 (ל- J.X.J) ו- F32DK134051 (ל- F.M.A), ומענק קרן וולש: AQ-1507 (ל- J.X.J). התוכן הוא באחריותם הבלעדית של המחברים ואינו מייצג בהכרח את הדעות הרשמיות של המכונים הלאומיים לבריאות. הדמויות נוצרו חלקית עם Biorender.com.
Materials
| 0.22 µm Filter | Corning | 431118 | For removing cellular debris from media |
| 35 mm x 10 mm Culture Dish | FisherScientific | 50-202-030 | For using during microinjection |
| Centrifuge | Fisherbrand | 13-100-676 | Spinning down solution |
| Constructs | GENEWIZ | – | For generation of constructs |
| Dissecting microscope | AmScope | SM-4TZ-144A | Visualization of lens for microinjection |
| DNA PCR primers | Integrated DNA Technologies | – | Generation of primers: Intracellular loop (IL)-deleted Cx50 (residues 1–97 and 149–400) as well as the Cla12NCO vector were obtained with the following pair of primers: sense, CTCCTGAGAACCTACATCCT; antisense, CACCGCATGCCCAAAGTACAC ILs of Cx43 (residues 98–150) and Cx46 (residues 98–166) were obtained with the following pairs of primers: sense, TACGTGATGAGGAAAGAAGAG; antisense, TCCTCCACGCATCTTTACCTTG; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCC AT ACGGATTC, respectively Cla12NCO-Cx43 construct template was obtained with the following pair of primers: sense, CTGCTTCGTACTTACATCATC; antisense, GAACAC GTGCGCCAGGTAC ILs of Cx50 (residues 98–148) or Cx46 (residues 98–166) were cloned by using Cla12NCO-Cx50 and Cla12NCO-Cx46 constructs as the templates with the following pair of primers: sense, CACCATGTCCGCATGGAGGAGA; antisense, GGTCCCC TC CAGGCGAAAC; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCCATACGGATTC, respectively |
| Drummond Nanoject II Automatic Nanoliter Injector | Drummond Scientific | 3-000-204 | Microinjection Pipet |
| Dual Gooseneck Lights Microscope Illuminator | AmScope | LED-50WY | Lighting for visualization |
| Dulbecco’s Modified Eagle Medium (DMEM) | Invitrogen | For cell culture | |
| Egg Holder | – | – | Homemade styrofoam rings with 2-inch diameter and one-half inch height |
| Egg Incubator | GQF Manufacturing Company Inc. | 1502 | For incubation of fertilized eggs |
| Fast Green | Fisher scientific | F99-10 | For visualization of viral stock injection |
| Fertilized white leghorn chicken eggs | Texas A&M University | N/A | Animal model of choice for microinjection (https://posc.tamu.edu/fertile-egg-orders/) |
| Fetal Bovine Serum (FBS) | Hyclone Laboratories | For cell culture | |
| Fluorescein-conjugated anti-mouse IgG | Jackson ImmunoResearch | 115-095-003 | For anti-FLAG 1:500 |
| Forceps | FisherScientific | 22-327379 | For moving things around and isolation |
| Glass capillaries | Sutter Instruments | B100-75-10 | Glass micropipette for microinjection (O.D. 1.0 mm, I.D. 0.75 mm, 10 cm length) |
| Lipofectamine | Invitrogen | L3000001 | For transfection |
| Manual vertical micropipette puller | Sutter Instruments | P-30 | To obtain glass micropipette of the correct size |
| Microcentrifuge Tubes | FisherScientific | 02-682-004 | Dissolving solution |
| Microscope | Keyence | BZ-X710 | For imaging staining |
| Parafilm | FisherScientific | 03-448-254 | Placing solution |
| Penicillin/Streptomycin | Invitrogen | For cell culture | |
| Pico-Injector | Harvard Apparatus | PLI-100 | For delivering small liquid volumes precisely through micropipettes by applying a regulated pressure for a digitally set period of time |
| rabbit anti-chick AQP0 | Self generated | – | Jiang JX, White TW, Goodenough DA, Paul DL. Molecular cloning and functional characterization of chick lens fiber connexin 45.6. Mol Biol Cell. 1994 Mar;5(3):363-73. doi: 10.1091/mbc.5.3.363. |
| rabbit anti-FLAG antibody | Rockland Immunichemicals | 600-401-383 | For staining FLAG |
| Rhodamine-conjugated anti-rabbit IgG | Jackson ImmunoResearch | 111-295-003 | For anti-AQP0 1:500 |
| Sponge clamping pad | Sutter Instruments | BX10 | For storage of glass micropipette |
Riferimenti
- Li, Z., Gu, S., Quan, Y., Varadaraj, K., Jiang, J. X. Development of a potent embryonic chick lens model for studying congenital cataracts in vivo. Communications Biology. 4 (1), 325 (2021).
- Chen, Y., et al. γ-Crystallins of the chicken lens: remnants of an ancient vertebrate gene family in birds. The FEBS Journal. 283 (8), 1516-1530 (2016).
- Coulombre, A. J., Coulombre, J. L. Lens development. I. Role of the lens in eye growth. Journal of Experimental Zoology. 156 (1), 39-47 (1964).
- McKeehan, M. S. Induction of portions of the chick lens without contact with the optic cup. The Anatomical Record. 132 (3), 297-305 (1958).
- Kothlow, S., Schenk-Weibhauser, K., Ratcliffe, M. J., Kaspers, B. Prolonged effect of BAFF on chicken B cell development revealed by RCAS retroviral gene transfer in vivo. Molecular immunology. 47 (7-8), 1619-1628 (2010).
- Fekete, D. M., Cepko, C. L. Replication-competent retroviral vectors encoding alkaline phosphatase reveal spatial restriction of viral gene expression/transduction in the chick embryo. Molecular and Cellular Biology. 13 (4), 2604-2613 (1993).
- Jiang, J. X. Use of retroviruses to express connexins. Methods in Molecular Biology. , 159-174 (2001).
- Jiang, J. X., Goodenough, D. A. Retroviral expression of connexins in embryonic chick lens. Investigative Ophthalmology & Visual Science. 39 (3), 537-543 (1998).
- Shestopalov, V. I., Bassnett, S. Expression of autofluorescent proteins reveals a novel protein permeable pathway between cells in the lens core. Journal of Cell Science. 113 (11), 1913-1921 (2000).
- Liu, J., Xu, J., Gu, S., Nicholson, B. J., Jiang, J. X. Aquaporin 0 enhances gap junction coupling via its cell adhesion function and interaction with connexin 50. Journal of Cell Science. 124 (2), 198-206 (2011).
- Li, Z., et al. The second extracellular domain of connexin 50 is important for in cell adhesion, lens differentiation, and adhesion molecule expression. Journal of Biological Chemistry. 299 (3), 102965 (2023).
- Shestopalov, V. I., Bassnett, S. Exogenous gene expression and protein targeting in lens fiber cells. Investigative Ophthalmology & Visual Science. 40 (7), 1435-1443 (1999).
- Shestopalov, V. I., Bassnett, S. Three-dimensional organization of primary lens fiber cells. Investigative Ophthalmology & Visual Science. 41 (3), 859-863 (2000).
- Hughes, S. H., Greenhouse, J. J., Petropoulos, C. J., Sutrave, P. Adaptor plasmids simplify the insertion of foreign DNA into helper-independent retroviral vectors. Journal of Virology. 61 (10), 3004-3012 (1987).
- Yan, R. T., Wang, S. Z. Production of high-titer RCAS retrovirus. Methods in Molecular Biology. 884, 193-199 (2012).
- Kingston, R. E. Introduction of DNA into mammalian cells. Current Protocols in Molecular Biology. 64 (1), 1-95 (2003).
- Li, Y., et al. Studying macrophage activation in immune-privileged lens through CSF-1 protein intravitreal injection in mouse model. STAR Protocols. 3 (1), 101060 (2022).
- Hamburger, V., Hamilton, H. L. A series of normal stages in the development of the chick embryo. Developmental Dynamics. 195 (4), 231-272 (1992).
- Hallagan, J. B., Allen, D. C., Borzelleca, J. F. The safety and regulatory status of food, drug and cosmetics colour additives exempt from certification. Food and Chemical Toxicology. 33 (6), 515-528 (1995).
- Okada, T. S., Eguchi, G., Takeichi, M. The expression of differentiation by chicken lens epithelium in in vitro cell culture. Development, Growth & Differentiation. 13 (4), 323-336 (1971).
- Menko, A. S., Klukas, K. A., Johnson, R. G. Chicken embryo lens cultures mimic differentiation in the lens. Biologia dello sviluppo. 103 (1), 129-141 (1984).
- Parreno, J., et al. Methodologies to unlock the molecular expression and cellular structure of ocular lens epithelial cells. Frontiers in Cell and Developmental Biology. 10, 983178 (2022).
- Edwards, A., Gupta, J. D., Harley, J. D. Photomicrographic evaluation of drug-induced cataracts in cultured embryonic chick lens. Experimental Eye Research. 15 (4), 495-498 (1973).
- Musil, L. S. Primary cultures of embryonic chick lens cells as a model system to study lens gap junctions and fiber cell differentiation. Journal of Membrane Biology. 245 (7), 357-368 (2012).
- West-Mays, J. A., Pino, G., Lovicu, F. J. Development and use of the lens epithelial explant system to study lens differentiation and cataractogenesis. Progress in Retinal and Eye Research. 29 (2), 135-143 (2010).
- Upreti, A., et al. Lens epithelial explants treated with vitreous humor undergo alterations in chromatin landscape with concurrent activation of genes associated with fiber cell differentiation and innate immune response. Cells. 12 (3), 501 (2023).
- Walker, J. L., Wolff, I. M., Zhang, L., Menko, A. S. Activation of SRC kinases signals induction of posterior capsule opacification. Investigative Ophthalmology & Visual Science. 48 (5), 2214-2223 (2007).
- Briskin, M. J., et al. Heritable retroviral transgenes are highly expressed in chickens. Proceedings of the National Academy of Sciences of the United States of America. 88 (5), 1736-1740 (1991).
- Hughes, S. H. The RCAS vector system. Folia Biologica. 50 (3-4), 107-119 (2004).
