Rekombinant RCAS(A) Retrovirüsünün Embriyonik Tavuk Lensine Mikroenjeksiyonu
Summary
Bu protokol belgesi, lens gelişimi sırasında in situ fonksiyon ve proteinlerin ekspresyonunu incelemek için bir araç olarak bir RCAS(A) retrovirüsünün embriyonik tavuk lensi mikroenjeksiyonunun metodolojisini açıklamaktadır.
Abstract
Embriyonik tavuk (Gallus domesticus), insan merceği ile yüksek derecede benzerliği göz önüne alındığında, mercek gelişimi ve fizyolojisi çalışmaları için köklü bir hayvan modelidir. RCAS(A), erken gelişim aşamalarında lens vezikülünün boş lümenine mikroenjeksiyon yoluyla lens gelişimi sırasında vahşi tip ve mutant proteinlerin in situ ekspresyonunu ve işlevini incelemek için güçlü bir araç görevi gören, bölünen hücreleri enfekte eden, replikasyona yetkin bir tavuk retrovirüsüdür. Transgenik modeller ve ex vivo kültürler gibi diğer yaklaşımlarla karşılaştırıldığında, RCAS(A) replikasyonuna yetkin bir kuş retrovirüsünün kullanılması, civciv embriyolarında eksojen proteinleri eksprese etmek için oldukça etkili, hızlı ve özelleştirilebilir bir sistem sağlar. Spesifik olarak, hedeflenen gen transferi, dokuya özgü promotörlere ihtiyaç duymadan proliferatif lens lifi hücreleriyle sınırlandırılabilir. Bu yazıda, rekombinant retrovirüs RCAS(A) hazırlığı için gereken adımları kısaca gözden geçireceğiz, mikroenjeksiyon prosedürüne ayrıntılı, kapsamlı bir genel bakış sunacağız ve tekniğin örnek sonuçlarını sunacağız.
Introduction
Bu protokolün amacı, bir RCAS(A)’nın (replikasyona yetkin kuş sarkomu/lökoz retrovirüsü A) embriyonik tavuk lensi mikroenjeksiyonunun metodolojisini tanımlamaktır. Embriyonik bir tavuk merceğinde etkili retroviral uygulamanın, normal mercek fizyolojisi, patolojik koşullar ve gelişiminde mercek proteinlerinin moleküler mekanizması ve yapı-işlevinin in vivo çalışması için umut verici bir araç olduğu gösterilmiştir. Ayrıca, bu deneysel model, terapötik hedeflerin tanımlanması ve insan konjenital kataraktları gibi durumlar için ilaç taraması için kullanılabilir. Toplamda, bu protokol, lens proteinlerinin incelenmesi için özelleştirilebilir bir platformun geliştirilmesi için gerekli adımları ortaya koymayı amaçlamaktadır.
Embriyonik civcivler (Gallus domesticus), lens yapısı ve insan merceği ile işlev bakımından benzerlikleri nedeniyle, mercek gelişimi ve fizyolojisi çalışmaları için köklü bir hayvan modelidir 1,2,3,4. RCAS(A) replikasyonuna yetkin bir kuş retrovirüsünün kullanımı, civciv embriyolarında eksojen proteinleri eksprese etmek için oldukça etkili, hızlı ve özelleştirilebilir bir sistem olarak kabul edilmiştir. Özellikle, boş lens lümeninin varlığının proliferatif lens fiber hücreleri içinde eksojen proteinlerin ekspresyonu için kısıtlı bölgeye yerinde RCAS (A) mikroenjeksiyonuna izin verdiği benzersiz embriyonik gelişim zaman çerçevesini kullanarak, dokuya özgü proliferatif lens lifi hücrelerine ihtiyaç duymadan hedef gen transferini proliferatif lens lifi hücrelerine sınırlamak için benzersiz bir yeteneğesahiptir 5, 6,7,8.
Burada derinlemesine açıklanan civciv embriyo mikroenjeksiyon prosedürü, başlangıçta kısmen Fekete et. al.6 ve Jiang et. al.8 ve hem viral hem de viral olmayan plazmitleri embriyonik civcivlerinmerceğine sokmanın bir yolu olarak kullanılmıştır 1,9,10,11,12,13. Genel olarak, önceki çalışma, lens gelişimini, farklılaşmasını, hücresel iletişimi ve hastalığın ilerlemesini incelemek ve katarakt gibi lens patolojik durumları için terapötik hedeflerin keşfi ve test edilmesi için bu metodolojiyi kullanma potansiyelini göstermektedir.
Protocol
Representative Results
Discussion
Bu deneysel model, bozulmamış mercekte ilgilenilen protein(ler)i ifade etme fırsatı sunar ve bu proteinlerin mercek yapısı ve işlevindeki işlevsel öneminin incelenmesine yol açar. Embriyonik civciv mikroenjeksiyon modeli kısmen Fekete et. al.6 ve Jiang et tarafından daha da geliştirildi. al.8 ve hem viral plazmitleri hem de agonistler, küçük enterferans yapan RNA (siRNA) ve peptitler gibi ajanlarıcivcivlerin merceğine 1,9,10,11,12,1…
Divulgazioni
The authors have nothing to disclose.
Acknowledgements
Bu çalışma Ulusal Sağlık Enstitüleri (NIH) Hibeleri tarafından desteklenmiştir: RO1 EY012085 (JXJ’ye) ve F32DK134051 (FMA’ya) ve Welch Vakfı hibesi: AQ-1507 (JXJ’ye). İçerik yalnızca yazarların sorumluluğundadır ve Ulusal Sağlık Enstitüleri’nin resmi görüşlerini temsil etmeyebilir. Figürler kısmen Biorender.com ile oluşturulmuştur.
Materials
| 0.22 µm Filter | Corning | 431118 | For removing cellular debris from media |
| 35 mm x 10 mm Culture Dish | FisherScientific | 50-202-030 | For using during microinjection |
| Centrifuge | Fisherbrand | 13-100-676 | Spinning down solution |
| Constructs | GENEWIZ | – | For generation of constructs |
| Dissecting microscope | AmScope | SM-4TZ-144A | Visualization of lens for microinjection |
| DNA PCR primers | Integrated DNA Technologies | – | Generation of primers: Intracellular loop (IL)-deleted Cx50 (residues 1–97 and 149–400) as well as the Cla12NCO vector were obtained with the following pair of primers: sense, CTCCTGAGAACCTACATCCT; antisense, CACCGCATGCCCAAAGTACAC ILs of Cx43 (residues 98–150) and Cx46 (residues 98–166) were obtained with the following pairs of primers: sense, TACGTGATGAGGAAAGAAGAG; antisense, TCCTCCACGCATCTTTACCTTG; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCC AT ACGGATTC, respectively Cla12NCO-Cx43 construct template was obtained with the following pair of primers: sense, CTGCTTCGTACTTACATCATC; antisense, GAACAC GTGCGCCAGGTAC ILs of Cx50 (residues 98–148) or Cx46 (residues 98–166) were cloned by using Cla12NCO-Cx50 and Cla12NCO-Cx46 constructs as the templates with the following pair of primers: sense, CACCATGTCCGCATGGAGGAGA; antisense, GGTCCCC TC CAGGCGAAAC; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCCATACGGATTC, respectively |
| Drummond Nanoject II Automatic Nanoliter Injector | Drummond Scientific | 3-000-204 | Microinjection Pipet |
| Dual Gooseneck Lights Microscope Illuminator | AmScope | LED-50WY | Lighting for visualization |
| Dulbecco’s Modified Eagle Medium (DMEM) | Invitrogen | For cell culture | |
| Egg Holder | – | – | Homemade styrofoam rings with 2-inch diameter and one-half inch height |
| Egg Incubator | GQF Manufacturing Company Inc. | 1502 | For incubation of fertilized eggs |
| Fast Green | Fisher scientific | F99-10 | For visualization of viral stock injection |
| Fertilized white leghorn chicken eggs | Texas A&M University | N/A | Animal model of choice for microinjection (https://posc.tamu.edu/fertile-egg-orders/) |
| Fetal Bovine Serum (FBS) | Hyclone Laboratories | For cell culture | |
| Fluorescein-conjugated anti-mouse IgG | Jackson ImmunoResearch | 115-095-003 | For anti-FLAG 1:500 |
| Forceps | FisherScientific | 22-327379 | For moving things around and isolation |
| Glass capillaries | Sutter Instruments | B100-75-10 | Glass micropipette for microinjection (O.D. 1.0 mm, I.D. 0.75 mm, 10 cm length) |
| Lipofectamine | Invitrogen | L3000001 | For transfection |
| Manual vertical micropipette puller | Sutter Instruments | P-30 | To obtain glass micropipette of the correct size |
| Microcentrifuge Tubes | FisherScientific | 02-682-004 | Dissolving solution |
| Microscope | Keyence | BZ-X710 | For imaging staining |
| Parafilm | FisherScientific | 03-448-254 | Placing solution |
| Penicillin/Streptomycin | Invitrogen | For cell culture | |
| Pico-Injector | Harvard Apparatus | PLI-100 | For delivering small liquid volumes precisely through micropipettes by applying a regulated pressure for a digitally set period of time |
| rabbit anti-chick AQP0 | Self generated | – | Jiang JX, White TW, Goodenough DA, Paul DL. Molecular cloning and functional characterization of chick lens fiber connexin 45.6. Mol Biol Cell. 1994 Mar;5(3):363-73. doi: 10.1091/mbc.5.3.363. |
| rabbit anti-FLAG antibody | Rockland Immunichemicals | 600-401-383 | For staining FLAG |
| Rhodamine-conjugated anti-rabbit IgG | Jackson ImmunoResearch | 111-295-003 | For anti-AQP0 1:500 |
| Sponge clamping pad | Sutter Instruments | BX10 | For storage of glass micropipette |
Riferimenti
- Li, Z., Gu, S., Quan, Y., Varadaraj, K., Jiang, J. X. Development of a potent embryonic chick lens model for studying congenital cataracts in vivo. Communications Biology. 4 (1), 325 (2021).
- Chen, Y., et al. γ-Crystallins of the chicken lens: remnants of an ancient vertebrate gene family in birds. The FEBS Journal. 283 (8), 1516-1530 (2016).
- Coulombre, A. J., Coulombre, J. L. Lens development. I. Role of the lens in eye growth. Journal of Experimental Zoology. 156 (1), 39-47 (1964).
- McKeehan, M. S. Induction of portions of the chick lens without contact with the optic cup. The Anatomical Record. 132 (3), 297-305 (1958).
- Kothlow, S., Schenk-Weibhauser, K., Ratcliffe, M. J., Kaspers, B. Prolonged effect of BAFF on chicken B cell development revealed by RCAS retroviral gene transfer in vivo. Molecular immunology. 47 (7-8), 1619-1628 (2010).
- Fekete, D. M., Cepko, C. L. Replication-competent retroviral vectors encoding alkaline phosphatase reveal spatial restriction of viral gene expression/transduction in the chick embryo. Molecular and Cellular Biology. 13 (4), 2604-2613 (1993).
- Jiang, J. X. Use of retroviruses to express connexins. Methods in Molecular Biology. , 159-174 (2001).
- Jiang, J. X., Goodenough, D. A. Retroviral expression of connexins in embryonic chick lens. Investigative Ophthalmology & Visual Science. 39 (3), 537-543 (1998).
- Shestopalov, V. I., Bassnett, S. Expression of autofluorescent proteins reveals a novel protein permeable pathway between cells in the lens core. Journal of Cell Science. 113 (11), 1913-1921 (2000).
- Liu, J., Xu, J., Gu, S., Nicholson, B. J., Jiang, J. X. Aquaporin 0 enhances gap junction coupling via its cell adhesion function and interaction with connexin 50. Journal of Cell Science. 124 (2), 198-206 (2011).
- Li, Z., et al. The second extracellular domain of connexin 50 is important for in cell adhesion, lens differentiation, and adhesion molecule expression. Journal of Biological Chemistry. 299 (3), 102965 (2023).
- Shestopalov, V. I., Bassnett, S. Exogenous gene expression and protein targeting in lens fiber cells. Investigative Ophthalmology & Visual Science. 40 (7), 1435-1443 (1999).
- Shestopalov, V. I., Bassnett, S. Three-dimensional organization of primary lens fiber cells. Investigative Ophthalmology & Visual Science. 41 (3), 859-863 (2000).
- Hughes, S. H., Greenhouse, J. J., Petropoulos, C. J., Sutrave, P. Adaptor plasmids simplify the insertion of foreign DNA into helper-independent retroviral vectors. Journal of Virology. 61 (10), 3004-3012 (1987).
- Yan, R. T., Wang, S. Z. Production of high-titer RCAS retrovirus. Methods in Molecular Biology. 884, 193-199 (2012).
- Kingston, R. E. Introduction of DNA into mammalian cells. Current Protocols in Molecular Biology. 64 (1), 1-95 (2003).
- Li, Y., et al. Studying macrophage activation in immune-privileged lens through CSF-1 protein intravitreal injection in mouse model. STAR Protocols. 3 (1), 101060 (2022).
- Hamburger, V., Hamilton, H. L. A series of normal stages in the development of the chick embryo. Developmental Dynamics. 195 (4), 231-272 (1992).
- Hallagan, J. B., Allen, D. C., Borzelleca, J. F. The safety and regulatory status of food, drug and cosmetics colour additives exempt from certification. Food and Chemical Toxicology. 33 (6), 515-528 (1995).
- Okada, T. S., Eguchi, G., Takeichi, M. The expression of differentiation by chicken lens epithelium in in vitro cell culture. Development, Growth & Differentiation. 13 (4), 323-336 (1971).
- Menko, A. S., Klukas, K. A., Johnson, R. G. Chicken embryo lens cultures mimic differentiation in the lens. Biologia dello sviluppo. 103 (1), 129-141 (1984).
- Parreno, J., et al. Methodologies to unlock the molecular expression and cellular structure of ocular lens epithelial cells. Frontiers in Cell and Developmental Biology. 10, 983178 (2022).
- Edwards, A., Gupta, J. D., Harley, J. D. Photomicrographic evaluation of drug-induced cataracts in cultured embryonic chick lens. Experimental Eye Research. 15 (4), 495-498 (1973).
- Musil, L. S. Primary cultures of embryonic chick lens cells as a model system to study lens gap junctions and fiber cell differentiation. Journal of Membrane Biology. 245 (7), 357-368 (2012).
- West-Mays, J. A., Pino, G., Lovicu, F. J. Development and use of the lens epithelial explant system to study lens differentiation and cataractogenesis. Progress in Retinal and Eye Research. 29 (2), 135-143 (2010).
- Upreti, A., et al. Lens epithelial explants treated with vitreous humor undergo alterations in chromatin landscape with concurrent activation of genes associated with fiber cell differentiation and innate immune response. Cells. 12 (3), 501 (2023).
- Walker, J. L., Wolff, I. M., Zhang, L., Menko, A. S. Activation of SRC kinases signals induction of posterior capsule opacification. Investigative Ophthalmology & Visual Science. 48 (5), 2214-2223 (2007).
- Briskin, M. J., et al. Heritable retroviral transgenes are highly expressed in chickens. Proceedings of the National Academy of Sciences of the United States of America. 88 (5), 1736-1740 (1991).
- Hughes, S. H. The RCAS vector system. Folia Biologica. 50 (3-4), 107-119 (2004).
