All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of Changchun University of Chinese Medicine. The materials are listed in the Table of Materials.
1. Animals and treatment
2. Blood pressure measurement
NOTE: Blood pressure measurements are performed using a noninvasive sphygmomanometer (Table of Materials).
3. Hematoxylin-eosin (HE) staining
4. Masson's trichrome staining
5. Hcy measurement by ELISA
6. RNA extraction and quantitative RT-PCR
7. Western blotting (WB)
8. Data analysis
As shown in Table 4 and Table 5, the systolic blood pressure (SBP) and diastolic blood pressure (DBP) were significantly greater in the MET group than those in the CON group from 1 to 4 weeks. After HTJDTLD treatment, the SBP and DBP of the rats were significantly lower than those in the MET group. Notably, the combined utilization of HTJDTLD and EM had a stronger antihypertensive effect than HTJDTLD treatment alone.
According to HE staining and Masson's trichrome staining, the endometrium of the aortic vessel wall was incomplete and not smooth, and the media was significantly thickened. There was smooth muscle cell proliferation and hypertrophy, the number of layers of arrangement increased, and the fibers were disordered in the MET group compared with those in the CON group. However, the vascular endometrium recovered more completely and smoothly, the media thickening was significantly reduced, and intimal damage in the MET + HTJDTLD + EM, MET + EM, and MET + HTJDTLD groups was significantly relieved (Figure 1 and Figure 2). Furthermore, the Hcy concentration in the methionine group was 2-fold greater than in the control group. However, the Hcy concentrations in the MET + HTJDTLD + EM, MET + EM, and MET + HTJDTLD groups were significantly lower than those in the MET group. Notably, the most significant reduction was found in the MET + HTJDTLD + EM group, which was approximately 1-fold lower than that in the MET group (Figure 3). The mRNA and protein expression results showed that the expression of GPR78, TRAF2, JNK, p-JNK, and caspase-3 was obviously upregulated after methionine treatment. However, HTJDTLD, EM, and the combination of HTJDTLD and EM significantly inhibited the upregulation of GPR78, TRAF2, JNK, and caspase-3. Notably, the combined application of HTJDTLD and EM had the most significant effect (Figure 4 and Figure 5).
Figure 1: HE staining. Thoracic aorta tissues histological changes from (A) CON group, (B) MET group, (C) MET + HTJDTLD + EM group, (D) MET + EM group, and (E) MET + HTJDTLD group. Nuclei are stained blue, whereas the cytoplasm and extracellular matrix have varying degrees of pink staining (100x). Please click here to view a larger version of this figure.
Figure 2: Masson staining. (A) CON group, (B) MET group, (C) MET + HTJDTLD + EM group, (D) MET + EM group and (E) MET + HTJDTLD group. Masson staining of aortic vessels in each group was performed to evaluate the effect of HTJDTLD on deposition and fibrosis (100x). Please click here to view a larger version of this figure.
Figure 3: The level of Hcy. The serum Hcy concentration of each group was detected by ELISA. Data were presented as mean ± SD (n = 6, SD are as follows: CON: 236.5 nmol/L, MET: 185 nmol/L, MET + HTJDTLD + EM: 126.8 nmol/L, MET + EM: 124 nmol/L, MET + HTJDTLD: 325 nmol/L). Please click here to view a larger version of this figure.
Figure 4: The mRNA expression of GRP78, TRAF2, JNK and caspase-3. After treatment with MET, MET + EM + HTJDTLD, and MET + EM, the expression of ERS-related genes was detected by qRT-PCR. Data were presented as mean ± SD (n = 6, SD as follows: GRP78 [CON: 0.12, MET: 0.13, MET + HTJDTLD + EM: 0.11, MET + EM: 0.17, MET + HTJDTLD: 0.12]; TRAF2 [CON: 0.09, MET: 0.09, MET + HTJDTLD + EM: 0.07, MET + EM: 0.11, MET + HTJDTLD: 0.13]; JNK [CON: 0.99, MET: 0.01, MET + HTJDTLD + EM: 0.03, MET + EM: 0.06, MET + HTJDTLD: 0.07; caspase-8 [CON: 0.06, MET: 0.10, MET + HTJDTLD + EM: 0.01, MET + EM: 0.13, MET + HTJDTLD: 0.03). * represents a significant difference compared with the CON group, # represents a significant difference compared with the MET group, Δ represents a significant difference compared with the MET + HTJDTLD group, and ∇ represents a significant difference compared with the MET + EM group. p < 0.01. Please click here to view a larger version of this figure.
Figure 5: The protein expression of GRP78, TRAF2, JNK, p-JNK and Caspase-3. (A) The protein samples were analyzed by western blotting with GRP78, TRAF2, JNK, p-JNK, and Caspase-3 antibodies. GAPDH was used as a control. (B) Quantification of GRP78, RAF2, JNK, p-JNK, and Caspase-3 proteins was determined by densitometry and has been normalized to GAPDH. Data were presented as mean ± SD (n = 6). * represents a significant difference compared with the CON group, p < 0.01. # represents a significant difference compared with the MET group, Δ represents a significant difference compared with the MET + HTJDTLD group, and ∇ represents a significant difference compared with the MET + EM group. p < 0.01. Please click here to view a larger version of this figure.
Reverse transcription reaction | |
Component | Volume (mL) |
Total RNA | 2 |
gDNA digester Mix | 3 |
SuperMix plus | 5 |
RNase-free Water | 10 |
The reaction program was as follows: 25 °C, 5 min; 55 °C, 15 min; 85 °C, 5 min. | |
RT-PCR | |
Component | Volume (mL) |
Template | 2 |
Forward Primer (10μM) | 0.4 |
Reverse Primer (10μM) | 0.4 |
Green qPCR Mix | 10 |
Nuclease-free Water | 7.2 |
The reaction program was as follows: pre-denaturation 95 °C, 5 min; denaturation 95 °C, 10 s; annealing/extension 60 °C, 45 s, for a total of 40 cycles. |
Table 1: Reverse transcription reaction volumes.
Primer name | Sequence (5’ to 3’) |
GPR78-F | CGTCGTATGTGGCCTTCACT |
GPR78-R | ATTCCAAGTGCGTCCGATGA |
TRAF2-F | GAAGGGAGCATTCCTAGACC |
TRAF2-R | GAAGGGAGCATTCCTAGACC |
JNK-F | GTCAGAATCCGAACGAGA |
JNK-R | GTCTACGCAGGCAATCG |
Caspase-3-F | GCGGTATTGAGACAGACAGTGGAAC |
Caspase-3-R | GCGGTAGAGTAAGCATACAGGAAGTC |
Table 2: List of primers.
10% separation gel, 5 mL system: | |
Component | Volume (mL) |
H2O | 1.9 |
30% acrylamide | 1.7 |
1.5 mol/L Tris-HCL (pH 8.8) | 1.3 |
10% SDS | 0.05 |
10% ammonium persulfate | 0.05 |
TEMED | 0.002 |
5% concentrated gel, 3 mL system: | |
Component | Volume (mL) |
H2O | 2.1 |
30% acrylamide | 0.5 |
1.0 mol/L Tris-HCL (pH 6.8) | 0.38 |
10% SDS | 0.03 |
10% ammonium persulfate | 0.03 |
TEMED | 0.003 |
Table 3: Composition of separation and concentrated gel.
Group | 1 week | 2 week | 3 week | 4 week |
CON | 163.4 ± 6 | 150.1 ± 7.0 | 134.2 ± 9.9 | 158.8 ± 10.2 |
MET | 192.1 ± 9.5## | 166.7 ± 12.8# | 177.3 ± 19.7## | 187 ± 23.6## |
MET+HTJDTLD+EM | 165.4 ± 9.2## | 148.9 ± 11.1* | 134.5 ± 12.3** | 159.2 ± 19.6** |
MET+EM | 173 ± 9.1## | 149.9 ± 18.7* | 145 ± 12.5** | 162.4 ± 19.1** |
MET+HTJDTLD | 176.7 ± 8.4## | 154.9 ± 22.8 | 168.3 ± 10.2 | 172.2 ± 17.4 |
Table 4: The changes in systolic pressure. #p < 0.05 and ##p < 0.01 vs. control group, *p <0.05 and **p < 0.01 vs. MET group.
Group | 1 week | 2 week | 3 week | 4 week |
CON | 138.4 ± 13.8 | 121.2 ± 12.5 | 107 ± 19.7 | 131.1 ± 16.3 |
MET | 147.9 ± 7.7# | 131 ± 11.9 | 143.7 ± 19.6## | 146 ± 21.4## |
MET+HTJDTLD+EM | 139.4 ± 10 | 123.1 ± 18.5 | 117.1 ± 9.6** | 129.2 ± 18.6** |
MET+EM | 140.9 ± 13.4 | 119.6 ± 7.8 | 123.6 ± 10.8** | 128 ± 25.2** |
MET+HTJDTLD | 140.4 ± 11.3 | 129.5 ± 11.1 | 138.3 ± 15.1 | 132.8 ± 16 |
Table 5: The changes in diastolic pressure.#p < 0.05 and ##p < 0.01 vs. control group, **p < 0.01 vs. MET group.
1st Strand cDNA Synthesis SuperMix for qPCR | Yeasen,China | 11149ES | cDNA synthesis kit |
Anti-beta-actin antibody | Bioss, China | bs-0061R | |
Anti-caspase-3 antibody | Bioss, China | bs-0081R | |
Anti-GPR78 antibody | Abcam, USA | ab108513 | |
Anti-JNK antibody | Abcam, USA | ab76572 | |
Anti-p-JNK antibody | Bioss, China | bsm-52462R | |
Anti-rabbit IgG antibody | Bioss, China | bs-0295G-HRP | |
Anti-TRAF2 antibody | Bioss, China | bs-22372R | |
Bio-Rad CFX96 Touch system | Bio-Rad | CFX96 | real-time PCR detection system |
ECL Western Blot Substrates | Merck, MA, USA | WBULP-10ML | |
Enalapril maleate folic acid tablets | Yangzijiang Pharmaceutical Company, China | 20040991 | |
FastStart SYBR Green Master | Sigma | FSSGMMRO | |
Fructus Trichosanthis | The First Affiliated Hospital of Changchun University of Traditional Chinese Medicine, China | No catalog number | |
Hirudo | The First Affiliated Hospital of Changchun University of Traditional Chinese Medicine, China | No catalog number | |
intelligent noninvasive sphygmomanometer | Beijing Softron Biotechnology company | BP-2010A | |
Lonicerae Japonicae Flos | The First Affiliated Hospital of Changchun University of Traditional Chinese Medicine, China | No catalog number | |
Methionine | Sigma, USA | M9500 | |
Radix Angelicae Sinensis | The First Affiliated Hospital of Changchun University of Traditional Chinese Medicine, China | No catalog number | |
Radix et Rhizoma Glycyrrhizae | The First Affiliated Hospital of Changchun University of Traditional Chinese Medicine, China | No catalog number | |
Radix et Rhizoma Nardostachyos | The First Affiliated Hospital of Changchun University of Traditional Chinese Medicine, China | No catalog number | |
Radix et Rhizoma Rhodiolae Crenulatae | The First Affiliated Hospital of Changchun University of Traditional Chinese Medicine, China | No catalog number | |
Radix et Rhizoma Salviae Miltiorrhizae | The First Affiliated Hospital of Changchun University of Traditional Chinese Medicine, China | No catalog number | |
Radix Scrophulariae | The First Affiliated Hospital of Changchun University of Traditional Chinese Medicine, China | No catalog number | |
Rat Hcy ELISA Kits | Shanghai Meimian Industrial Company, China | MM-0293R2 | |
RIPA buffer | Shanghai Beyotime Biotechnology company | P0013B |
H-type hypertension, which is a specific form of hypertension characterized by elevated plasma homocysteine (Hcy) levels, has become a major public health challenge worldwide. This study investigated the hypotensive effects and underlying mechanisms of Huotan Jiedu Tongluo decoction (HTJDTLD), a highly effective traditional Chinese medicine formula commonly used to treat vascular stenosis. Methionine was used to induce H-type hypertension in rats, and HTJDTLD was administered intragastrically. Then, the systolic and diastolic blood pressures of the caudal artery of rats were measured by noninvasive rat caudal manometry. Histological assessment of the aorta was performed by hematoxylin-eosin (HE) staining. Enzyme-linked immunosorbent assay (ELISA) was used to measure Hcy levels, and quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) and western blotting were used to determine the mRNA and protein levels of Glucose regulatory protein 78 (GRP78), Tumor necrosis factor (TNF) receptor-associated factor 2 (TRAF2), c-Jun N-terminal kinases (JNK), and caspase-3. The results showed that HTJDTLD significantly lowered blood pressure, alleviated histopathological lesions, and decreased Hcy levels after methionine treatment. Moreover, HTJDTLD significantly inhibited the gene and protein expression of GRP78, JNK, TRAF2, and caspase 3, which are involved mainly in the endoplasmic reticulum (ER) stress-induced apoptosis pathway. Overall, the results indicated that HTJDTLD had effective antihypertensive effects in rats with H-type hypertension and revealed the antihypertensive mechanisms associated with inhibition of ER stress-induced apoptosis pathway activation.
H-type hypertension, which is a specific form of hypertension characterized by elevated plasma homocysteine (Hcy) levels, has become a major public health challenge worldwide. This study investigated the hypotensive effects and underlying mechanisms of Huotan Jiedu Tongluo decoction (HTJDTLD), a highly effective traditional Chinese medicine formula commonly used to treat vascular stenosis. Methionine was used to induce H-type hypertension in rats, and HTJDTLD was administered intragastrically. Then, the systolic and diastolic blood pressures of the caudal artery of rats were measured by noninvasive rat caudal manometry. Histological assessment of the aorta was performed by hematoxylin-eosin (HE) staining. Enzyme-linked immunosorbent assay (ELISA) was used to measure Hcy levels, and quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) and western blotting were used to determine the mRNA and protein levels of Glucose regulatory protein 78 (GRP78), Tumor necrosis factor (TNF) receptor-associated factor 2 (TRAF2), c-Jun N-terminal kinases (JNK), and caspase-3. The results showed that HTJDTLD significantly lowered blood pressure, alleviated histopathological lesions, and decreased Hcy levels after methionine treatment. Moreover, HTJDTLD significantly inhibited the gene and protein expression of GRP78, JNK, TRAF2, and caspase 3, which are involved mainly in the endoplasmic reticulum (ER) stress-induced apoptosis pathway. Overall, the results indicated that HTJDTLD had effective antihypertensive effects in rats with H-type hypertension and revealed the antihypertensive mechanisms associated with inhibition of ER stress-induced apoptosis pathway activation.
H-type hypertension, which is a specific form of hypertension characterized by elevated plasma homocysteine (Hcy) levels, has become a major public health challenge worldwide. This study investigated the hypotensive effects and underlying mechanisms of Huotan Jiedu Tongluo decoction (HTJDTLD), a highly effective traditional Chinese medicine formula commonly used to treat vascular stenosis. Methionine was used to induce H-type hypertension in rats, and HTJDTLD was administered intragastrically. Then, the systolic and diastolic blood pressures of the caudal artery of rats were measured by noninvasive rat caudal manometry. Histological assessment of the aorta was performed by hematoxylin-eosin (HE) staining. Enzyme-linked immunosorbent assay (ELISA) was used to measure Hcy levels, and quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) and western blotting were used to determine the mRNA and protein levels of Glucose regulatory protein 78 (GRP78), Tumor necrosis factor (TNF) receptor-associated factor 2 (TRAF2), c-Jun N-terminal kinases (JNK), and caspase-3. The results showed that HTJDTLD significantly lowered blood pressure, alleviated histopathological lesions, and decreased Hcy levels after methionine treatment. Moreover, HTJDTLD significantly inhibited the gene and protein expression of GRP78, JNK, TRAF2, and caspase 3, which are involved mainly in the endoplasmic reticulum (ER) stress-induced apoptosis pathway. Overall, the results indicated that HTJDTLD had effective antihypertensive effects in rats with H-type hypertension and revealed the antihypertensive mechanisms associated with inhibition of ER stress-induced apoptosis pathway activation.