This protocol paper describes the methodology of embryonic chicken lens microinjection of an RCAS(A) retrovirus as a tool for studying in situ function and expression of proteins during lens development.
Embryonic chicken (Gallus domesticus) is a well-established animal model for the study of lens development and physiology, given its high degree of similarity with the human lens. RCAS(A) is a replication-competent chicken retrovirus that infects dividing cells, which serves as a powerful tool to study the in situ expression and function of wild-type and mutant proteins during lens development by microinjection into the empty lumen of lens vesicle at early developmental stages, restricting its action to surrounding proliferating lens cells. Compared to other approaches, such as transgenic models and ex vivo cultures, the use of an RCAS(A) replication-competent avian retrovirus provides a highly effective, rapid, and customizable system to express exogenous proteins in chick embryos. Specifically, targeted gene transfer can be confined to proliferative lens fiber cells without the need for tissue-specific promoters. In this article, we will briefly overview the steps needed for recombinant retrovirus RCAS(A) preparation, provide a detailed, comprehensive overview of the microinjection procedure, and provide sample results of the technique.
The goal of this protocol is to describe the methodology of embryonic chicken lens microinjection of an RCAS(A) (replication-competent avian sarcoma/leukosis retrovirus A). Effective retroviral delivery in an embryonic chicken lens has been demonstrated to be a promising tool for the in vivo study of the molecular mechanism and structure-function of lens proteins in normal lens physiology, pathological conditions, and development. Moreover, this experimental model could be used for the identification of therapeutic targets and drug screening for conditions such as human congenital cataracts. In all, this protocol aims to lay out the necessary steps for the development of a customizable platform for the study of lens proteins.
Embryonic chicks (Gallus domesticus), owing to their similarity in lens structure and function with the human lens, are a well-established animal model for the study of lens development and physiology1,2,3,4. The use of an RCAS(A) replication-competent avian retrovirus has been regarded as a highly effective, rapid, and customizable system to express exogenous proteins in chick embryos. Notably, it has a unique ability to confine the target gene transfer to proliferative lens fiber cells without the need for tissue-specific promoters, using the unique embryonic development time frame in which the presence of empty lens lumen permits in situ RCAS(A) microinjection into the restricted site for the expression of exogenous proteins within proliferative lens fiber cells5,6,7,8.
The chick embryo microinjection procedure, described in-depth here, is based originally partially on the work of Fekete et. al.6 and further developed by Jiang et. al.8 and has been utilized as a means of introducing both viral and nonviral plasmids into the lens of embryonic chicks1,9,10,11,12,13. Overall, the previous work demonstrates the potential of utilizing this methodology to study lens development, differentiation, cellular communication, and disease progression, and for the discovery and testing of therapeutic targets for lens pathological conditions such as cataracts.
This study was conducted in compliance with the Animal Welfare Act and the Implementing Animal Welfare Regulations in accordance with the principles of the Guide for the Care and Use of Laboratory Animals. All animal procedures were approved by the Institutional Animal Care and Use Committee at the University of Texas Health Science Center at San Antonio. For an overview of the protocol, see Figure 1; see the Table of Materials for details on all materials, reagents, and instruments used in this protocol.
Figure 1: Experimental outline. 1. The first step of the protocol is the determination of a specific target protein(s), the identification of the associated gene sequence(s), and DNA fragment generation. 2. Cloning of the gene sequence(s) into a retroviral vector by initial cloning into an adaptor vector, 3. followed by a viral vector. 4. Preparation of high-titer viral particles using packaging cells to harvest and concentrate. 5. The final step, and the focus of this protocol, is the chicken lens microinjection of the RCAS(A) viral particles into the lens lumen. Please click here to view a larger version of this figure.
1. Preparation of high-titer recombinant retroviruses
Figure 2: Instruments and setup for chick lens microinjection. (A) P-30 manual vertical microelectrode micropipette puller. (1) inset showing a glass micropipette being pulled. (B) (2) Egg Incubator. Incubate chicken egg for ~65-68 h in a 37 °C incubator to reach stage 18 (with a sealed, empty central lumen) for injection of retrovirus. (C) Microinjection setup. (3) lighting equipment, (4) Pico-Injector, (5) dissecting microscope, (6) Drummond micromanipulator, (7) computer/camera for visualization. Please click here to view a larger version of this figure.
2. Chick lens microinjection
Figure 3: Microinjection chick prep and schematic. (A) Opening of a chicken egg. (B) Cutting of the amniotic membrane. (C) Chicken lens lumen microinjection schematic. Please click here to view a larger version of this figure.
After the determination of a specific target protein(s) and the identification of the associated gene sequence(s), the overall experimental approach involves the cloning of the gene sequence(s) into a retroviral RCAS(A) vector by the initial cloning into an adaptor vector, followed by a viral vector. Second, high-titer viral particles are prepared using packaging cells to harvest and concentrate the virions. These first two major steps have been largely described and representative results presented elsewhere6,7,8,14,16.
For this protocol, the main area of focus is the step of microinjection. It is imperative to determine the success of the in situ microinjection of RCAS(A) viral particles containing DNA fragments of the protein target of interest, both at the time of injection and after lens isolation. Figure 4 shows an image of the lens lumen pre- and post-injection of the viral vectors dyed with Fast Green for visualization and confirming the proper localization into the lens lumen. Fast Green is a dye with a high degree of safety and is approved by the U.S. Food and Drug Administration as a color additive used to color food, drugs, and cosmetics19.
Figure 5 shows the histological evaluation through immunofluorescence of the target protein, the chimeric connexin Cx50*43L, which was introduced into high-titer recombinant retroviruses, microinjected into the lens lumen and evaluated. Since the C-termini of the chimeric connexins were epitope-tagged with FLAG sequences, anti-flag labeling was used to identify the exogenous connexins from the endogenous ones, using standard staining methodology, with sagittal and coronal sections (sagittal shown here), as described in Liu et al.10 Although Cx50*43L is localized on the plasma membrane, because of the orientation of the tissue sections prepared, it appears to localize inside the lens in certain regions. In this study, the interaction between the intercellular loop domain of Cx50 and AQP0 was evaluated and stained accordingly10.
Figure 4: Example of microinjection into the chicken lens lumen. (A) Preinjection into lens lumen. (B) Post injection into lens lumen. Arrow = injection site. Please click here to view a larger version of this figure.
Figure 5: Microinjection and histological evaluation. At stage 18 of embryonic development, which is ~65-68 h of embryonic development, a microinjection of recombinant retroviruses containing chimeric Cx50*43L mutant was done into the empty lumen of a chick lens. We examined the cryosections of chick lenses dissected out on embryonic day 18, which were immunolabeled with FLAG (green) and AQP0 (red) antibodies. Fluorescein-conjugated anti-mouse IgG was used to detect primary antibodies against anti-FLAG, while rhodamine-conjugated anti-rabbit IgG was used to detect primary antibodies against anti-AQP0. The visualization of immunostaining was done using confocal fluorescence microscopy. The corresponding merged images, labeled as "Merged", can be seen on the right. Scale bar = 50 µm. Please click here to view a larger version of this figure.
This experimental model offers the opportunity to express the protein(s) of interest in the intact lens leading to the study of the functional relevance of these proteins in lens structure and function. The embryonic chick microinjection model is based partially on the work of Fekete et. al.6 and was further developed by Jiang et. al.8 and has been utilized as a means of inserting both viral plasmids and agents such as agonists, small interfering RNA (siRNA), and peptides into the lens of chicks1,9,10,11,12,13. This platform is ideal for investigating the mechanisms triggering disease development alongside testing possible drug targets for lens pathological conditions such as congenital cataracts. As our understanding of lens pathological conditions improves and genetic or acquired mutations are identified, this cost-effective animal model allows for the study of the underlying mechanisms surrounding the development of these conditions or outcomes of mutations, which can help address the large medical need of non-surgical and reliable treatment regimens for lens conditions1. Additionally, this system offers an in vivo system to characterize wild-type and mutated proteins with respect to protein assembly and aggregation, as recently described1,11. This model could be applied for broad use beyond the lens.
RCAS(A) is a replication-competent avian retrovirus8. Its use, in combination with an embryonic chicken lens (a well-established animal model for the study of lens development and physiology1,2,3,4), is regarded as a unique and effective means of expressing exogenous proteins in chick embryos. Given the unique chick embryonic developmental timeline and structure, with the lens, at development stage 18 (~65-68 h embryonic development), separating from the ectoderm and forming a sealed vesicle with a central lumen, this primes for the microinjection into this empty lens lumen to restrict expression to proliferative lens cells7,8,18. Though mostly a strength for our purpose, it is also notably a limitation as due to the nature of the retroviral injection, only proliferative cells are altered through this methodology. The transfection (injection) by retroviruses is not a transient expression and exogenous genes are incorporated into the genome. This gene delivery approach is very effective and previous data show almost all proliferative cells can be infected8,10. Notably, our previous studies showed that microinjection alone does not cause apparent damage to the lens as determined by lens morphology and lack of cataract formation at the point of injection1.
In contrast to this approach, in vitro approaches using cultured lens cells can be utilized, but are limited to the recapitulation of the early stages of lens fiber development20,21,22,23,24. Additionally, ex vivo lens explant systems have also been widely used as a means to study lens differentiation and cataractogenesis25,26. This model and related lens capsule cultures27, though powerful, are simplistic culture models, which have limitations and complexities depending on their intended application24,26. The use of transgenic approaches in either mouse or chicken lens has had various limitations, with the murine lens not sharing substantial similarities to the human lens1,2,3,4, and chicken lenses have had limitations in efficiency and stability28.
When performing the protocol, great care must be taken to ensure adequate amplification of DNA fragments, retrovirus tittering, transfection, and sterile preparation of viral stocks because bacterial and yeast contamination in microinjection can cause lethality to chick embryos7. For the microinjection itself, critical steps are the correct localization of chick embryo and lens alongside positioning of the micropipette into the lens lumen and careful attention must be paid to not overfill the lens capsule during injection. In general, practice should be done with careful notation of anatomical sites and extra eggs should be prepped for the experiment to account for error. Anomalies during the microinjection process, such as accidental rupturing of blood vessels should be noted, and the use of those embryos avoided. Additionally, limitations of the RCAS retroviral system should be kept in mind, such as its ability to create ectopic expression of a gene outside of a set window or location, lack of ease of regulation of the expression level, and lastly, there are limitations to the sizing of the insert, particularly >2 kb15,29. Finally, care should be taken in choosing the time point of evaluation. In this experiment, we selected up to embryonic day 18 which is close to egg hatching, to determine the overall impact of exogenous gene expression on intact lens. After injection, the hatching rate is very low and most of embryos cannot survive due to disruption of the vitelline membrane.
In conclusion, the use of this RCAS(A) chicken lens microinjection model presents a highly effective, rapid, and customizable system to express exogenous proteins to allow the design and expression of proteins to address their function in lens physiology and development.
The authors have nothing to disclose.
This work was supported by the National Institutes of Health (NIH) Grants: RO1 EY012085 (to J.X.J) and F32DK134051 (to F.M.A), and Welch Foundation grant: AQ-1507 (to J.X.J.). The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. The figures were partially created with Biorender.com.
0.22 µm Filter | Corning | 431118 | For removing cellular debris from media |
35 mm x 10 mm Culture Dish | FisherScientific | 50-202-030 | For using during microinjection |
Centrifuge | Fisherbrand | 13-100-676 | Spinning down solution |
Constructs | GENEWIZ | – | For generation of constructs |
Dissecting microscope | AmScope | SM-4TZ-144A | Visualization of lens for microinjection |
DNA PCR primers | Integrated DNA Technologies | – | Generation of primers: Intracellular loop (IL)-deleted Cx50 (residues 1–97 and 149–400) as well as the Cla12NCO vector were obtained with the following pair of primers: sense, CTCCTGAGAACCTACATCCT; antisense, CACCGCATGCCCAAAGTACAC ILs of Cx43 (residues 98–150) and Cx46 (residues 98–166) were obtained with the following pairs of primers: sense, TACGTGATGAGGAAAGAAGAG; antisense, TCCTCCACGCATCTTTACCTTG; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCC AT ACGGATTC, respectively Cla12NCO-Cx43 construct template was obtained with the following pair of primers: sense, CTGCTTCGTACTTACATCATC; antisense, GAACAC GTGCGCCAGGTAC ILs of Cx50 (residues 98–148) or Cx46 (residues 98–166) were cloned by using Cla12NCO-Cx50 and Cla12NCO-Cx46 constructs as the templates with the following pair of primers: sense, CACCATGTCCGCATGGAGGAGA; antisense, GGTCCCC TC CAGGCGAAAC; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCCATACGGATTC, respectively |
Drummond Nanoject II Automatic Nanoliter Injector | Drummond Scientific | 3-000-204 | Microinjection Pipet |
Dual Gooseneck Lights Microscope Illuminator | AmScope | LED-50WY | Lighting for visualization |
Dulbecco’s Modified Eagle Medium (DMEM) | Invitrogen | For cell culture | |
Egg Holder | – | – | Homemade styrofoam rings with 2-inch diameter and one-half inch height |
Egg Incubator | GQF Manufacturing Company Inc. | 1502 | For incubation of fertilized eggs |
Fast Green | Fisher scientific | F99-10 | For visualization of viral stock injection |
Fertilized white leghorn chicken eggs | Texas A&M University | N/A | Animal model of choice for microinjection (https://posc.tamu.edu/fertile-egg-orders/) |
Fetal Bovine Serum (FBS) | Hyclone Laboratories | For cell culture | |
Fluorescein-conjugated anti-mouse IgG | Jackson ImmunoResearch | 115-095-003 | For anti-FLAG 1:500 |
Forceps | FisherScientific | 22-327379 | For moving things around and isolation |
Glass capillaries | Sutter Instruments | B100-75-10 | Glass micropipette for microinjection (O.D. 1.0 mm, I.D. 0.75 mm, 10 cm length) |
Lipofectamine | Invitrogen | L3000001 | For transfection |
Manual vertical micropipette puller | Sutter Instruments | P-30 | To obtain glass micropipette of the correct size |
Microcentrifuge Tubes | FisherScientific | 02-682-004 | Dissolving solution |
Microscope | Keyence | BZ-X710 | For imaging staining |
Parafilm | FisherScientific | 03-448-254 | Placing solution |
Penicillin/Streptomycin | Invitrogen | For cell culture | |
Pico-Injector | Harvard Apparatus | PLI-100 | For delivering small liquid volumes precisely through micropipettes by applying a regulated pressure for a digitally set period of time |
rabbit anti-chick AQP0 | Self generated | – | Jiang JX, White TW, Goodenough DA, Paul DL. Molecular cloning and functional characterization of chick lens fiber connexin 45.6. Mol Biol Cell. 1994 Mar;5(3):363-73. doi: 10.1091/mbc.5.3.363. |
rabbit anti-FLAG antibody | Rockland Immunichemicals | 600-401-383 | For staining FLAG |
Rhodamine-conjugated anti-rabbit IgG | Jackson ImmunoResearch | 111-295-003 | For anti-AQP0 1:500 |
Sponge clamping pad | Sutter Instruments | BX10 | For storage of glass micropipette |