जीनोम चौड़ा जीन में विलोपन<em> Streptococcus sanguinis</em> उच्च Throughput पीसीआर द्वारा
Summary
एक कुशल जीनोम चौड़ा एक जीन उत्परिवर्तन विधि का उपयोग कर स्थापित किया गया है<em> Streptococcus sanguinis</em> एक मॉडल जीव के रूप में. इस विधि उच्च throughput रीकॉम्बीनैंट PCRs और परिवर्तनों के माध्यम से हासिल किया गया है.
Abstract
Transposon mutagenesis and single-gene deletion are two methods applied in genome-wide gene knockout in bacteria 1,2. Although transposon mutagenesis is less time consuming, less costly, and does not require completed genome information, there are two weaknesses in this method: (1) the possibility of a disparate mutants in the mixed mutant library that counter-selects mutants with decreased competition; and (2) the possibility of partial gene inactivation whereby genes do not entirely lose their function following the insertion of a transposon. Single-gene deletion analysis may compensate for the drawbacks associated with transposon mutagenesis. To improve the efficiency of genome-wide single gene deletion, we attempt to establish a high-throughput technique for genome-wide single gene deletion using Streptococcus sanguinis as a model organism. Each gene deletion construct in S. sanguinis genome is designed to comprise 1-kb upstream of the targeted gene, the aphA-3 gene, encoding kanamycin resistance protein, and 1-kb downstream of the targeted gene. Three sets of primers F1/R1, F2/R2, and F3/R3, respectively, are designed and synthesized in a 96-well plate format for PCR-amplifications of those three components of each deletion construct. Primers R1 and F3 contain 25-bp sequences that are complementary to regions of the aphA-3 gene at their 5′ end. A large scale PCR amplification of the aphA-3 gene is performed once for creating all single-gene deletion constructs. The promoter of aphA-3 gene is initially excluded to minimize the potential polar effect of kanamycin cassette. To create the gene deletion constructs, high-throughput PCR amplification and purification are performed in a 96-well plate format. A linear recombinant PCR amplicon for each gene deletion will be made up through four PCR reactions using high-fidelity DNA polymerase. The initial exponential growth phase of S. sanguinis cultured in Todd Hewitt broth supplemented with 2.5% inactivated horse serum is used to increase competence for the transformation of PCR-recombinant constructs. Under this condition, up to 20% of S. sanguinis cells can be transformed using ~50 ng of DNA. Based on this approach, 2,048 mutants with single-gene deletion were ultimately obtained from the 2,270 genes in S. sanguinis excluding four gene ORFs contained entirely within other ORFs in S. sanguinis SK36 and 218 potential essential genes. The technique on creating gene deletion constructs is high throughput and could be easy to use in genome-wide single gene deletions for any transformable bacteria.
Protocol
Representative Results
Discussion
पड़ोसी जीन पर exogenous एंटीबायोटिक दवाओं जीन के साथ एक लक्षित जीन के प्रतिस्थापन के संभव ध्रुवीय प्रभाव को कम करने के लिए, दो कदम जबकि प्रारंभिक प्राइमर डिजाइन ले रहे हैं. हटाए गए जीनों के अधिकांश के लिए, प्र…
Disclosures
The authors have nothing to disclose.
Acknowledgements
इस काम R01DE018138 स्वास्थ्य (PX) के राष्ट्रीय संस्थानों से अनुदान और भाग में समर्थित किया गया था, वर्जीनिया कॉमनवेल्थ विश्वविद्यालय राष्ट्रपति रिसर्च प्रोत्साहन कार्यक्रम (PRIP) 144602-3 (px). हम डीआरएस धन्यवाद. Lei चेन, Yuetan दोगुनी और जीनोम चौड़ा म्यूटेंट के निर्माण के साथ सहायता के लिए वैंग Xiaojing. हम भी वर्जीनिया कॉमनवेल्थ विश्वविद्यालय में डीएनए अनुक्रमण के लिए डीएनए कोर सुविधा धन्यवाद.
Materials
| Names | Company | Catalog# | Comments (optional) |
| Primer F2 | Integrated DNA Technologies | TGACTAACTAGGAGGAATAAATG GCTAAAATGAGAATAT |
|
| Primer R2 | ibid | CATTATTCCCTCCAGGTACTAAAA CAATTCATCCAGT |
|
| Primer F2p | ibid | GATAAACCCAGCGAACCATTTGA | |
| Primer P1 | ibid | GCTTATATACCTTAGCAGGAGACA | |
| Primer P2 | ibid | GTATGACATTGCCTTCTGCGTCC | |
| Primer 5′ end_R1_seq | ibid | GCCATTTATTCCTCCTAGTTAGTCA | |
| Primer 5′ end_F3_seq | ibid | GTTTTAGTACCTGGAGGGAATAATG | |
| Primer 5′ end_R1p_seq | ibid | CCTCAAATGGTTCGCTGGGTTTATC | |
| CSP | Synprep | Sequence:NH2-DLRGVPNPWGWIFGR-COOH | |
| DNA Polymerase | Invitrogen | 11304-102 | Platinum Taq DNA Polymerase High Fidelity |
| EcoRI | New England Biolabs Inc | R0101S | Restriction enzyme |
| Agar | American Bioanalytical | AB01185 | |
| Agarose | Promega | V3125 | |
| BHI | BD Biosciences | 237500 | Brain Heart Infusion |
| Horse serum | Fisher Scientific | SH3007403 | Horse serum |
| Km | Fisher Scientific | BP906-5 | Kanamycin |
| TH broth | BD Biosciences | 249240 | Todd Hewitt broth |
| PureLink 96 | Invitrogen | K310096 | PureLink 96 PCR purification kit |
| QIAquick | Qiagen | 28106 | QIAquick PCR purification kit |
| Filter | Corning | 431117 | 0.22 μm polystyrene filter |
| Anoxomat System | Mart Microbiology b.v. | Anoxomat Mark II | |
| Benchtop centrifuge | Thermo Scientific | 75004377 | Sorvall Legend RT Plus microplate rotor |
| Gel Documentation | UVP LLC | BioDoc-It 210 | |
| Incubator | Fisher Scientific | 11-690-625D | Isotemp |
| Labnet’s Gel XL | Labnet | E0160 | Labnet’s Gel XL |
| Microcentrifuge | Eppendorf | 22621408 | Microcentrifuge 5415 R |
| Multichannel pipettes | Thermo Scientfic | 4661040, 4661020 | Finnpipette F1 |
| Thermal Cycler | Applied Biosystems Inc. | N805-0200 | GeneAmp PCR system 9700 |
References
- Sassetti, C. M., Boyd, D. H., Rubin, E. J. Genes required for mycobacterial growth defined by high density mutagenesis. Mol. Microbiol. 48, 77-84 (2003).
- Kobayashi, K., et al. Essential Bacillus subtilis genes. Proc. Natl. Acad. Sci. U.S.A. 100, 4678-4683 (2003).
- Trieu-Cuot, P., Courvalin, P. Nucleotide sequence of the Streptococcus faecalis plasmid gene encoding the 3’5″-aminoglycoside phosphotransferase type III. Gene. 23, 331-341 (1983).
- Paik, S., et al. Identification of virulence determinants for endocarditis in Streptococcus sanguinis by signature-tagged mutagenesis. Infect. Immun. 73, 6064-6074 (2005).
- Lukomski, S., et al. Nonpolar inactivation of the hypervariable streptococcal inhibitor of complement gene (sic) in serotype M1 Streptococcus pyogenes significantly decreases mouse mucosal colonization. Infect. Immun. 68, 535-542 (2000).
- Baba, T., et al. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2, (2006).
- de Berardinis, V. A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1. Mol. Syst. Biol. 4, 174 (2008).
- Rodriguez, A. M., et al. Physiological and molecular characterization of genetic competence in Streptococcus sanguinis. Mol. Oral. Microbiol. 26, 99-116 (2011).
- Perry, D., Kuramitsu, H. K. Genetic transformation of Streptococcus mutans Infect. Immun. 32, 1295-1297 (1981).
- Pakula, R., Walczak, W. On the nature of competence of transformable streptococci. J. Gen. Microbiol. 31, 125-133 (1963).
- Datsenko, K. A., Wanner, B. L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 97, 6640-6645 (2000).
- Xu, P., et al. Genome-wide essential gene identification in Streptococcus sanguinis. Sci. Rep. 1, (2011).
