게놈 전체 유전자 삭제할에<em> 연쇄상 구균 sanguinis</em> 높은 처리량 PCR에 의한
Summary
효율적인 게놈 전체의 단일 유전자 돌연변이 방법은 사용하는 설립되었습니다<em> 연쇄상 구균 sanguinis</em> 모델 생물로. 이 방법은 높은 처리량 재조합 PCRs 및 변환을 통해 달성했다.
Abstract
Transposon mutagenesis 및 단일 유전자 삭제 박테리아 1,2의 게놈 전체 유전자 녹아웃에 적용된 두 가지 방법이 있습니다. transposon의 mutagenesis이 적은 시간이 소요 적은 비용이 많이 드는, 그리고 완성 된 게놈 정보를 요구하지 않습니다하지만,이 방법은 두 약점이 있습니다 : 감소 경쟁과 뮤턴트 카운터 선택하는 혼합 돌연변이 라이브러리의 서로 다른 돌연변이 (1) 가능성, (2) 일부 유전자 불 활성화의 가능성은 상기 유전자가 완전히 transposon의 삽입에 따라 자신의 기능을 잃게하지 않습니다. 단일 유전자 삭제 분석 transposon의 mutagenesis와 관련된 단점을 보완 할 수 있습니다. 게놈 전체의 단일 유전자 삭제의 효율성을 개선하기 위해, 우리는 모델 생물로 연쇄상 구균의 sanguinis를 사용하여 게놈 전체의 단일 유전자 삭제에 대한 높은 처리량 기술을 확립하려고합니다. 각 유전자 삭제 S.에 구축 sanguinis 게놈는 1을 구성하도록 설계되었습니다타겟 유전자 aphA-3 유전자 인코딩 kanamycin 저항 단백질, 그리고 타겟 유전자의 1 이하 하류-KB 상류. 프리 머 F1/R1, F2/R2, 그리고 F3/R3 세 세트를 각각 설계, 각 삭제 그 세 가지 구성 요소 구성의 PCR-amplifications을위한 96 – 웰 플레이트 형식으로 합성됩니다. 프리 머 R1과 F3는 5 '끝 부분에있는 aphA-3 유전자의 지역에 보완 25 BP 시퀀스가 포함되어 있습니다. aphA-3 유전자의 대규모 PCR 증폭은 모든 단일 유전자 삭제 구조를 만드는 한 번 수행됩니다. aphA-3 유전자의 프로모터는 처음 kanamycin 카세트의 잠재력 극성 효과를 최소화하기 위해 제외됩니다. 유전자 삭제 구조를 만들려면, 높은 처리량 PCR의 증폭 및 정화는 96 – 웰 플레이트 형식으로 수행됩니다. 각 유전자 삭제에 대한 선형 재조합 PCR의 amplicon는 고 충실도의 DNA 중합 효소를 사용하여 네 PCR 반응을 통해 구성됩니다. 초기 exponS.의 ential 성장 단계 2.5 % inactivated 말 혈청이 PCR-재조합 구조의 변화에 대한 능력을 향상하는 데 사용됩니다와 토드 휴이트 국물에 배양 sanguinis이 보충. S.의 조건, 최대 20 % sanguinis 세포는 DNA의 ~ 50 NG를 통해 변환 할 수 있습니다. 이 방법에 따라, 단일 유전자 삭제로 2048 뮤턴트은 궁극적으로 S.에있는 2,270 유전자에서 얻은되었습니다 네 유전자 ORFs 제외 sanguinis은 S.의 다른 ORFs 내에 완전히 포함 sanguinis SK36 218 가능성이 필수적인 유전자. 유전자 삭제 구조를 만드는 방법에 대한 기술은 높은 처리량이며, 모든 transformable 박테리아 게놈 전체의 단일 유전자 삭제에 사용하기 쉬운 될 수 있습니다.
Protocol
Representative Results
Discussion
초기 뇌관이 설계하면서 이웃 유전자에 대한 외인성 항생제 유전자과 하나가 타겟 유전자의 교체 가능한 극성 효과를 최소화하기 위해 두 단계 이동합니다. 삭제 된 유전자의 대부분은 프리 머 R1과 F3는 사전 정지 코돈 30 BP로 시작 코돈에 따라 6 BP에서 코딩 영역을 삭제할 수 있도록 설계되었습니다. 지난 30 기본 쌍은 인접 하류 유전자에 의해 사용 가능성 ribosomal 구속력이 사이트를 보호하기 위?…
Disclosures
The authors have nothing to disclose.
Acknowledgements
이 작품은 버지니아 커먼 웰스 대학의 대통령 연구 인센티브 프로그램 (PRIP) 144602-3 (PX)에 의해, 건강 (PX)의 국립 연구소에서 보조금 R01DE018138 의해 부분적으로 지원되었다. 우리는 Drs 감사드립니다. 레이 첸, 게놈 전체 돌연변이의 건설을 지원에 Yuetan쪽으로 앉아야하고 왕을 Xiaojing. 우리는 또한 DNA 배열을 위해 버지니아 커먼 웰스 대학에서 DNA 핵심 시설 감사드립니다.
Materials
| Names | Company | Catalog# | Comments (optional) |
| Primer F2 | Integrated DNA Technologies | TGACTAACTAGGAGGAATAAATG GCTAAAATGAGAATAT |
|
| Primer R2 | ibid | CATTATTCCCTCCAGGTACTAAAA CAATTCATCCAGT |
|
| Primer F2p | ibid | GATAAACCCAGCGAACCATTTGA | |
| Primer P1 | ibid | GCTTATATACCTTAGCAGGAGACA | |
| Primer P2 | ibid | GTATGACATTGCCTTCTGCGTCC | |
| Primer 5′ end_R1_seq | ibid | GCCATTTATTCCTCCTAGTTAGTCA | |
| Primer 5′ end_F3_seq | ibid | GTTTTAGTACCTGGAGGGAATAATG | |
| Primer 5′ end_R1p_seq | ibid | CCTCAAATGGTTCGCTGGGTTTATC | |
| CSP | Synprep | Sequence:NH2-DLRGVPNPWGWIFGR-COOH | |
| DNA Polymerase | Invitrogen | 11304-102 | Platinum Taq DNA Polymerase High Fidelity |
| EcoRI | New England Biolabs Inc | R0101S | Restriction enzyme |
| Agar | American Bioanalytical | AB01185 | |
| Agarose | Promega | V3125 | |
| BHI | BD Biosciences | 237500 | Brain Heart Infusion |
| Horse serum | Fisher Scientific | SH3007403 | Horse serum |
| Km | Fisher Scientific | BP906-5 | Kanamycin |
| TH broth | BD Biosciences | 249240 | Todd Hewitt broth |
| PureLink 96 | Invitrogen | K310096 | PureLink 96 PCR purification kit |
| QIAquick | Qiagen | 28106 | QIAquick PCR purification kit |
| Filter | Corning | 431117 | 0.22 μm polystyrene filter |
| Anoxomat System | Mart Microbiology b.v. | Anoxomat Mark II | |
| Benchtop centrifuge | Thermo Scientific | 75004377 | Sorvall Legend RT Plus microplate rotor |
| Gel Documentation | UVP LLC | BioDoc-It 210 | |
| Incubator | Fisher Scientific | 11-690-625D | Isotemp |
| Labnet’s Gel XL | Labnet | E0160 | Labnet’s Gel XL |
| Microcentrifuge | Eppendorf | 22621408 | Microcentrifuge 5415 R |
| Multichannel pipettes | Thermo Scientfic | 4661040, 4661020 | Finnpipette F1 |
| Thermal Cycler | Applied Biosystems Inc. | N805-0200 | GeneAmp PCR system 9700 |
References
- Sassetti, C. M., Boyd, D. H., Rubin, E. J. Genes required for mycobacterial growth defined by high density mutagenesis. Mol. Microbiol. 48, 77-84 (2003).
- Kobayashi, K., et al. Essential Bacillus subtilis genes. Proc. Natl. Acad. Sci. U.S.A. 100, 4678-4683 (2003).
- Trieu-Cuot, P., Courvalin, P. Nucleotide sequence of the Streptococcus faecalis plasmid gene encoding the 3’5″-aminoglycoside phosphotransferase type III. Gene. 23, 331-341 (1983).
- Paik, S., et al. Identification of virulence determinants for endocarditis in Streptococcus sanguinis by signature-tagged mutagenesis. Infect. Immun. 73, 6064-6074 (2005).
- Lukomski, S., et al. Nonpolar inactivation of the hypervariable streptococcal inhibitor of complement gene (sic) in serotype M1 Streptococcus pyogenes significantly decreases mouse mucosal colonization. Infect. Immun. 68, 535-542 (2000).
- Baba, T., et al. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2, (2006).
- de Berardinis, V. A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1. Mol. Syst. Biol. 4, 174 (2008).
- Rodriguez, A. M., et al. Physiological and molecular characterization of genetic competence in Streptococcus sanguinis. Mol. Oral. Microbiol. 26, 99-116 (2011).
- Perry, D., Kuramitsu, H. K. Genetic transformation of Streptococcus mutans Infect. Immun. 32, 1295-1297 (1981).
- Pakula, R., Walczak, W. On the nature of competence of transformable streptococci. J. Gen. Microbiol. 31, 125-133 (1963).
- Datsenko, K. A., Wanner, B. L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 97, 6640-6645 (2000).
- Xu, P., et al. Genome-wide essential gene identification in Streptococcus sanguinis. Sci. Rep. 1, (2011).
