Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics.
Due to the high level of heterogeneity and mutations inherent in human cancers, single agent therapies, or combination regimens which target the same pathway, are likely to fail. Emphasis must be placed upon the inhibition of pathways that are responsible for intrinsic and/or adaptive resistance to therapy. An active field of investigation is the development and testing of DNA repair inhibitors that promote the action of, and prevent resistance to, commonly used chemotherapy and radiotherapy. We used a novel protocol to evaluate the effectiveness of BRCA2 inhibition as a means to sensitize tumor cells to the DNA damaging drug cisplatin. Tumor cell metabolism (acidification and respiration) was monitored in real-time for a period of 72 hr to delineate treatment effectiveness on a minute by minute basis. In combination, we performed an assessment of metastatic frequency using a chicken embryo chorioallantoic membrane (CAM) model of extravasation and invasion. This protocol addresses some of the weaknesses of commonly used in vitro and in vivo methods to evaluate novel cancer therapy regimens. It can be used in addition to common methods such as cell proliferation assays, cell death assays, and in vivo murine xenograft studies, to more closely discriminate amongst candidate targets and agents, and select only the most promising candidates for further development.
Acquired resistance to targeted and/or cytotoxic cancer treatment is an important clinical problem that can lead to treatment failure, relapse, and increased patient mortality1. Given the high level of heterogeneity in most tumors, it is a mathematical certainty that a tumor of sufficiently high cell number will contain a subset of cells resistant to single or combined therapies targeting molecular pathways on which those cells depend for survival2,3. Such tumor cells can be positively selected for during treatment, leading to disease recurrence. Development of novel therapies that simultaneously target different cancer cell survival mechanisms, either before or after treatment-mediated selection, is thus clinically important.
A high level of genome instability and mutation in tumor genomes is a fundamental characteristic that distinguishes cancer cells from non-tumor host cells4. Consequently, a useful strategy to increase the effectiveness of DNA-damaging chemotherapy and to prevent the development of resistance is to actively inhibit DNA repair in tumor cells5. This is an active field of investigation and a variety of novel DNA repair targets are being explored in a pre-clinical setting. A number of small molecule or antisense-based inhibitors of these targets have been developed and are undergoing testing6-8. The objective is to identify the most promising pre-clinical candidates and evaluate their safety and efficacy in clinical trials.
The high cost of clinical trials and the risk of failure (for a variety of reasons including sub-optimal pre-clinical evaluation) are formidable obstacles to progress in development of new therapies9. The use of appropriate and rigorous pre-clinical models to adequately evaluate new therapeutic targets and candidate drugs may decrease the high failure rate of clinical trials10.
Some commonly-used pre-clinical methods to evaluate the effectiveness of novel anti-cancer regimens are: a) measurement of capacity to reduce tumor cell proliferation in vitro (cell proliferation assays), b) therapy-induced reduction in capacity of tumor cells to form tissue culture colonies (colony formation assays), c) therapy-induced reduction in tumor cell metabolic activity in vitro (redox-dye conversion) , d) therapy-induced induction of in vitro tumor cell death (apoptotic, necrotic, autophagic, associated with mitosis and others)11, and e) in vivo therapy-induced reduction of growth or ablation of human and mouse xenografts12-14.
A major weakness of the listed in vitro methods is that none of them provide continuous real-time evaluation of the effect of candidate therapies. Rather, they provide information only at selected, widely-separated time points during the course of treatment. Such measurements have diminished capacity to accurately reflect the magnitude and timing of tumor cell responses. In vivo mouse xenograft models are also limited by high cost, length of time to complete, and risk of sub-optimal dosing and treatment timing (scheduling). In addition, there is evidence that rodent xenograft models are limited predictors of clinical efficacy in humans, compared to in vitro assessment of responses of primary human tumor cells and established human tumor cell lines to candidate therapeutic interventions15,16.
We devised a novel combination protocol to evaluate new drug combinations pre-clinically, in a manner that addresses the weaknesses of the more common procedures listed above. In place of proliferation, colony formation, or redox-dye conversion assays, we utilized a metabolism measurement unit to analyze cell adhesion, respiration, and acidification in real time during the entire treatment period17. Simultaneously, we investigated the effects of treatment combination in vivo by using a chicken embryo chorioallantoic membrane (CAM) model of invasion and metastasis18,19. We used these methods to evaluate the ability of an antisense oligonucleotide (ASO) targeting BRCA2 to potentiate the effectiveness of the commonly used chemotherapeutic drug cisplatin.
NOTE: The following protocol was designed for use with adherent cells. Modifications are required to apply the method to non-adherent cells grown in suspension. The CAM experiments described in the protocol are designed for use with cells that express a fluorescent marker (e.g., GFP, RFP, etc.). Nine day old chicken embryos are required on day 2 of the experimental protocol for the CAM experiments.
1. Preparation and Transfection of Tumor Cells with Antisense Oligonucleotides (ASOs)
2. Biosensor Chip Preparation and Cell Seeding
3. Metabolism Measurement System Preparation and Solution Preparation
4. CAM Experiment Drug Treatment and Injection
NOTE: The steps and procedure for preparing chicken embryos for a CAM experiment are described elsewhere19
5. Metastatic Focus Enumeration
Results and figures adapted with permission from published work22.
BRCA2 inhibition induces a decrease in respiration in cisplatin treated tumor cells
Human A549 lung cancer cells treated with BRCA2-targeting ASO and cisplatin exhibited an early and irreversible decrease in respiration, compared to cells which received control ASO and cisplatin alone; after 24 hr of cisplatin treatment the difference in respiration between BRCA2 ASO and control ASO treated cells was 39% (Figure 1A). Importantly, this decrease in respiration started before a detectable drop in cell adhesion, suggesting that this occurred independent of changes in cell number. Respiration began to decrease approximately 10 hr before the first observable drop in adhesion, suggesting that a drop in respiration may be a formative event that precedes cell death (Figure 1B). No difference in acidification was observed during the 72 hr experiment time-frame, suggesting that BRCA2 ASO and cisplatin treatment has little to no effect on glucose metabolism (Figure 1C).
BRCA2 inhibition combined with cisplatin treatment decreases the frequency of metastasis
Human A549 lung cancer cells were treated with control ASO or BRCA2 ASO in the presence or absence of cisplatin, and injected into the venous circulation of the CAM (Figure 2A). Nine days following injection, cells treated with BRCA2 ASO and cisplatin exhibited a 77% lower frequency of metastatic foci compared to cells treated with control ASO and cisplatin, or BRCA2 ASO alone (Figure 2B). This suggests that BRCA2 ASO and cisplatin treatment has the potential to decrease or prevent metastatic burden in patients with solid tumors.
Figure 1. Real-time monitoring of tumor cell adherence, respiration, and acidification. A549 cells were transfected with BRCA2 ASO, plated onto biosensor chips, and treated with cisplatin for 24hrs using the Bionas Discovery System. Measurements of (A) respiration, (B) adherence, and (C) acidification were performed every 4 min over a period of 72 hr. Pink = control ASO, blue = BRCA2 ASO, green = control ASO + cisplatin, red = BRCA2 ASO + cisplatin. Figure adapted from published work with permission22. Please click here to view a larger version of this figure.
Figure 2. Enumerating metastatic frequency using a chicken embryo CAM model. A549 cells transfected with BRCA2 ASO were treated with cisplatin for 6 hr, and then injected into the venous circulation of a 9 day old chicken embryo (A). Metastatic foci (B) (visualized using a confocal microscope with a 40x objective) were counted nine days following injection (C). Figure adapted from published work with permission22. Please click here to view a larger version of this figure.
Due to the inherent cost and risk associated with clinical trials, there is a need to develop better and more rigorous pre-clinical testing methodology to adequately evaluate novel anti-cancer treatment regimens. Current commonly-used techniques all exhibit weaknesses that may limit their capacity to discriminate between potentially promising therapeutic targets/agents, and those that may be less effective. We devised a protocol to evaluate new anti-cancer approaches that addresses many of the shortcomings of traditional methods.
A particularly important feature of the described protocol is the ability to measure cellular responses in real time, and to track changes in metabolism and adherence minute by minute. This allows for the identification of peak drug effects, optimal dosing and a more detailed understanding of the interaction between the components of drug combination treatment. Simultaneously, it provides insight into discrete metabolic alterations in cancer cells, which is information that is not provided by cell counting, apoptosis, or dye-conversion assays. A limitation of this assay is the inability to accurately determine the type of cell death that is occurring during drug treatment. Changes in viability will be reflected by changes in adherence to the biosensor chip, but this does not provide information regarding the manner of cell death. It is also possible to use fluorescence microscopy and live cell imaging techniques to determine similar metabolic data, and this can be used in addition to the experiments described in this protocol20,21.
Furthermore, use of the chicken embryo CAM model to study metastatic frequency following treatment is an effective way to determine whether a new target, drug, or drug combination decreases the frequency of cancer cells which extravasate and/or invade surrounding tissue. This is a particularly relevant question from a clinical standpoint, because metastatic disease causes a high proportion of mortality amongst cancer patients. A potential limiting factor is that actual drug treatment does not occur in the CAM. Instead it occurs ex vivo and the pre-treated cells are then injected into the CAM. Therefore, this assay does not provide information regarding drug uptake or distribution in vivo. In addition, the intravenous CAM injections are technically challenging and require significant practice/experience.
We used this protocol to evaluate the ability of a BRCA2-targeting ASO to sensitize tumor cells to the DNA damaging drug cisplatin. The results of our experiments identified BRCA2 as a promising target for therapeutic attack, and also provided rationale for further pre-clinical development of the BRCA2 ASO as a candidate drug. We envision this protocol being used to identify novel targets for combination treatment, particularly in the burgeoning field of DNA repair inhibition. We feel this protocol will be best used in addition to the more common techniques in cancer biology, in an effort to more stringently evaluate new anti-cancer approaches.
The authors have nothing to disclose.
This work was made possible by grants to JK from the Ontario Centres of Excellence and the Ontario Research Fund.
We would like to thank Siddika Pardhan and Dr. Peter Ferguson for technical assistance during filming.
Name of Material/ Equipment | Company | Catalog Number | Comments/Description |
A549 cells | ATCC | CCL-185 | http://www.atcc.org/products/all/CCL-185.aspx |
AeraSeal film | Carl Roth GmbH | ||
AMEM | Wisent Bioproducts | 210-011-QK | |
Antisense oligodeoxynucleotides | Avecia | BRCA2 target sequence: 5' – UAAGGAACGUCAAGAGAUAC – 3' (bases 7241-7259 ) | |
Axio Zoom V16 Microscope | Carl Zeiss | http://www.zeiss.ca/microscopy/en_ca/products/stereo-zoom-microscopes/axio-zoom-v16.html | |
Bionas Biosensor Chips | Bionas GmbH and Micronas GmbH | BIS8001D | |
Bionas Discovery 2500 System | Bionas GmbH | http://www.bionas-discovery.com/prodservices/instruments/system2500/ | |
Cisplatin | Sigma Aldrich | 479306 | |
Fertilized chicken eggs | Sourced locally | ||
Fetal bovine serum | Gibco – Life Technologies | ||
Lipofectamine 2000 | Invitrogen – Life Technologies | 12566014 | http://www.lifetechnologies.com/ca/en/home/life-science/protein-expression-and-analysis/transfection-selection/lipofectamine-2000.html |
PBS | Wisent Bioproducts | 311-010-CL | |
Trypsin (0.25%)/EDTA | Wisent Bioproducts | 325-043-CL |