Bedingte Genetische transsynaptische Tracing in der embryonalen Maus-Gehirn
Summary
Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution.
Abstract
Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits during embryonic maturation of the brain however is technically challenging because most transsynaptic tracing methods developed to date depend on stereotaxic tracer injection. To overcome this problem, we developed a binary genetic strategy for conditional genetic transsynaptic tracing in the mouse brain. Towards this end we generated two complementary knock-in mouse strains to selectively express the bidirectional transsynaptic tracer barley lectin (BL) and the retrograde transsynaptic tracer Tetanus Toxin fragment C from the ROSA26 locus after Cre-mediated recombination. Cell-specific tracer production in these mice is genetically encoded and does not depend on mechanical tracer injection. Therefore our experimental approach is suitable to study neural circuit formation in the embryonic murine brain. Furthermore, because tracer transfer across synapses depends on synaptic activity, these mouse strains can be used to analyze the communication between genetically defined neuronal populations during brain development at a single cell resolution. Here we provide a detailed protocol for transsynaptic tracing in mouse embryos using the novel recombinant ROSA26 alleles. We have utilized this experimental technique in order to delineate the neural circuitry underlying maturation of the reproductive axis in the developing female mouse brain.
Introduction
Anatomische Pfadverfolgung ist eine der am häufigsten verwendeten Werkzeuge, um die Beziehung zwischen Gehirn und Verhalten 1 entziffern. Fortschritt in neuronalen Schaltkreis Tracing Technologien hat Neurowissenschaftler mit der Fähigkeit, neuronale Schaltkreise genetisch identifiziert Neuronenpopulationen in Mäusen 2 Spuren verliehen. Trotz dieser technischen Fortschritt bleibt es schwierig, die Bildung von neuronalen Schaltkreisen vor allem während der embryonalen Reifung zu entwirren. Das ist, weil die meisten der bisher entwickelten Tracing-Verfahren basieren auf stereotaktische Injektion von transsynaptische Tracer oder gentechnisch veränderten neurotropen Viren (Abbildung 1) 2,3 basierend. Während diese Techniken zu erreichen räumliche und zeitliche Auflösung der Konnektivität, mehrere inhärente Beschränkungen wie technisch anspruchs Tracer Injektionen in das sich entwickelnde Gehirn, die Reproduzierbarkeit der Injektionsstelle, potenzielle Entzündung an der Injektionsstelle und wich-tantly Zytotoxizität von neurotropen Viren verursacht begrenzen ihre Verwendung 4.
Eine alternative Methode ist es, die transsynaptische Tracer als Transgene in genetisch veränderten Mäusen exprimieren. Vor kurzem haben wir diese Technik modifiziert und eine binäre genetische transsynaptische Tracing-System, um die neuronalen Schaltkreise eines genetisch identifiziert neuronalen Population 5 Karte entwickelt. Unsere experimentellen Strategie basiert auf zwei neuen Knock-in Mausstämme, die entweder die bidirektionale Tracer Gerstenlektin (BL) 6 oder die retrograde Tracer-Tetanustoxin-Fragment C bis GFP (GTT) 7 von der ROSA 26 Ort verschmolzen Ausdruck basiert nach Cre-vermittelte Rekombination. Hier verwendeten wir diese Mäusestämme, selektiv auszudrücken BL und GTT in Neuronen, kisspeptin erzeugen, ein Neuropeptid, das bei der Regulierung der Reifung des reproduktiven Achse 8,9 gebracht wird. Wir zeigen, dass diese Technik geeignet ist, die Entwicklung und Reifung der Kuss visualisierenPeptin neuronalen Schaltkreise während der embryonalen Entwicklung des weiblichen Maushirn 5.
Zuchtstrategie
Die R26-BL-IRES-τlacZ (BIZ) und die R26-GFP-TTC (GTT) Begleitheizungsleitungen sind Knock-in-Stämme, die rekombinante 5 ROSA26 Allele tragen. Die R26-BIZ und die R26-GTT Allele transkriptional stumm aufgrund der Gegenwart einer starken Transkriptionsstoppsignal, das von zwei loxP-Stellen flankiert ist 5. Expression des BIZ und GTT Transgen durch Cre-vermittelte Entfernung des transkriptionellen Stop-Signal aktiviert. Die R26-BIZ und R26 GTT-Allele können unabhängig voneinander einfach durch Kreuzung mit einem Cre Fahrer verwendet werden. Zur Analyse Tiere, die heterozygot für die jeweiligen Cre und R26 Allele verwendet werden. Wurf Durchführung einer Cre oder ein Allel R26 jeweils als Kontrollen verwendet werden. Alternativ ist es auch möglich, zu erzeugen triple Knock-in Tiere, die die Cre, R26 und R26-BIZ-GTT-Allele jedoch wird dies eine zusätzliche Quer erfordern.
Protocol
Representative Results
Discussion
Ausdruck transsynaptische Tracer als Transgene, die neuronale Schaltkreise genetisch definierten neuronalen Populationen verfolgen hat mehrere Vorteile gegenüber dem stereotaktische Injektion von Tracern oder neurotopic Viren. Zuerst wird der Tracer als endogenes Protein erzeugt und daher keine Immunantwort hervorzurufen und eine selektive neuralen Weg kann in verschiedenen Tieren, die mit hoher Reproduzierbarkeit zu analysieren. Zweitens, weil dies eine nicht-invasive Methode kann verwendet werden, um die Schaltungen …
Disclosures
The authors have nothing to disclose.
Acknowledgements
We thank Michael Candlish for critical comments on the manuscript. This project was supported by the Deutsche Forschungsgemeinschaft grants BO1743/6 and SFB/TRR 152 P11 and Z02 to Ulrich Boehm.
Materials
| Name of Material/ Equipment | Company | Catalog Number | Comments/Description |
| Bisbenzimide (Hoechst 33258 dye) | Sigma | 14530-100MG | |
| Ethanol | Sigma | 32205-1L | |
| Cryo mold (Peel-a-way) | Polyscience Inc. | 18646A-1 | 22mm x 22mm x 20mm |
| DMSO | Sigma | D8418-100ML | |
| Dimethyl Formamide (DMF) | VWR Chemicals | 23470,293 | |
| EGTA | ROTH | 3054.3 | |
| Fluoromount G | Southern Biotech | 0100-01 | |
| Glutaraldehyde | Sigma | G5882-50ML | |
| Hydrogen peroxide | Sigma | 34988-7 | |
| Isopentane (Methyl 2-butane) | Sigma | M32631-2.5L | |
| Kaiser's Glycine gelatin | Merck | 1092420100 | |
| Methanol | Sigma | 494437-1L | |
| MgCl2 | Sigma | M2670-100G | |
| NaCl | ROTH | HN00.2 | |
| NBT | Sigma | 298-83-9 | |
| Nonidet P40 substitute | Fluka | 743.85 | |
| OCT | Leica | 14020108926 | |
| PAP pen | Dako | S2002 | |
| Parafarmaldehyde | Sigma | P6148-1KG | |
| Sodium deoxycholate | Sigma | D6750-25G | |
| Sucrose | Sigma | S7903-1KG | |
| Superfrost slides | Thermo Scientific | FT4981GLPLUS | |
| TSA kit | PerkinElmer | NEL700 | |
| TSA plus kit | PerkinElmer | NEL749A001KT | |
| Tris | ROTH | AE15.2 | |
| Triton-X 100 | ROTH | 3051.2 | |
| Tween 20 | ROTH | 9127.1 | |
| X-gal | ROTH | 2315.1 | |
| Cryostat | Leica | na | |
| Light microscope equipped with DIC imaging | Zeiss | Axioskop2 equipped with Axio Vision software | |
| Fluroscence microscope | Zeiss | Axioskop2 equipped with Axio Vision software | |
| Photoshop | Adobe | PS6 | |
| Goat anti-WGA (recognizes BL) | Vector Laboatories | AS-2024 | |
| Biotinylayted horse anti-goat IgG | Vector Laboatories | BA-9500 | |
| Biotinylated goat anti-rabbit IgG | Vector Laboatories | BA-1000 | |
| Rabbit anti-GFP (recognizes GTT) | Invitrogen | A11122 | |
| Rabbit anti-GnRH | Affinity Bio Reagent | PA1-121 | |
| Dylight488-donkey anti-rabbit IgG | Thermo Scientific | SA5-10038 | |
| SA-Alexa Fluor 546 | Life Technologies | S-11225 | |
| Primers | |||
| BL Fwd (for BIZ genotyping) | Eurofins MWG Operon | ATGAAGATGATGAGCACCAG GGC |
|
| BL Rev (for BIZ genotyping) | Eurofins MWG Operon | AGCCCTCGCCGCAGAACTC | |
| Cre Fwd (for Cre genotyping) | Eurofins MWG Operon | GTCGATGCAACGAGTGATGAG GTTCG |
|
| Cre Rev (for Cre genotyping) | Eurofins MWG Operon | CCAGGCTAAGTGCCTTCTCTAC ACCTGC |
|
| TTC Fwd (for GTT genotyping) | Eurofins MWG Operon | AGCAAGGGCGAGGAGCTGTT | |
| TTC Rev (for GTT genotyping) | Eurofins MWG Operon | GTCTTGTAGTTGCCGTCGTCCT TGAA |
|
| XY Fwd (for gender genotyping) | Eurofins MWG Operon | TGAAGCTTTTGGCTTTGA | |
| XY Rev (for gender genotyping) | Eurofins MWG Operon | CCGCTGCCAAATTCTTTG | |
| ROSA26 Fwd | Eurofins MWG Operon | CGAAGTCGCTCTGAGTTGTTATC | |
| ROSA26 Rev | Eurofins MWG Operon | GCAGATGGAGCGGGAGAAAT | |
| SA Rev | Eurofins MWG Operon | CGAAGTCGCTCTGAGTTGTTATC | |
References
- Vercelli, A., Repici, M., Garbossa, D., Grimaldi, A. Recent techniques for tracing pathways in the central nervous system of developing and adult mammals. Brain. Res. Bull. 51, 11-28 (2000).
- Huang, Z. J., Zeng, H. Genetic approaches to neural circuits in the mouse. Annu. Rev. Neurosci. 36, 183-215 (2013).
- Lanciego, J. L., Wouterlood, F. G. A half century of experimental neuroanatomical tracing. J. Chem. Neuroanat. 42, 157-183 (2011).
- DeFalco, J., et al. Virus-assisted mapping of neural inputs to a feeding center in the hypothalamus. Science. 291, 2608-2613 (2001).
- Kumar, D., et al. Murine arcuate nucleus kisspeptin neurons communicate with GnRH neurons in utero. J. Neurosci. 34, 3756-3766 (2014).
- Horowitz, L. F., Montmayeur, J. P., Echelard, Y., Buck, L. B. A genetic approach to trace neural circuits. Proc. Natl. Acad. Sci. U.S.A. 96, 3194-3199 (1999).
- Maskos, U., Kissa, K., ST Cloment, C., Brulet, P. Retrograde trans-synaptic transfer of green fluorescent protein allows the genetic mapping of neuronal circuits in transgenic mice. Proc. Natl. Acad. Sci. U.S.A. 99, 10120-10125 (2002).
- De Roux, N., et al. Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54. Proc. Natl. Acad. Sci. U.S.A. 100, 10972-10976 (2003).
- Seminara, S. B., et al. The GPR54 gene as a regulator of puberty. N. Engl. J. Med. 349, 1614-1627 (2003).
- Mayer, C., et al. Timing and completion of puberty in female mice depend on estrogen receptor alpha-signaling in kisspeptin neurons. Proc. Natl. Acad. Sci. U.S.A. 107, 22693-22698 (2010).
- Soriano, P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat. Genet. 21, 70-71 (1999).
- Seibler, J., et al. Single copy shRNA configuration for ubiquitous gene knockdown in mice. Nucleic Acids Res. 33, e67 (2005).
- Semaan, S. J., Kauffman, A. S. Emerging concepts on the epigenetic and transcriptional regulation of the Kiss1 gene. Int. J. Dev. Neurosci. 31, 452-462 (2013).
- Feil, R., et al. Ligand-activated site-specific recombination in mice. Proc. Natl. Acad. Sci. U.S.A. 93, 10887-10890 (1996).
