배아 마우스의 뇌에 추적 조건부 유전 Transsynaptic
Summary
Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution.
Abstract
Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits during embryonic maturation of the brain however is technically challenging because most transsynaptic tracing methods developed to date depend on stereotaxic tracer injection. To overcome this problem, we developed a binary genetic strategy for conditional genetic transsynaptic tracing in the mouse brain. Towards this end we generated two complementary knock-in mouse strains to selectively express the bidirectional transsynaptic tracer barley lectin (BL) and the retrograde transsynaptic tracer Tetanus Toxin fragment C from the ROSA26 locus after Cre-mediated recombination. Cell-specific tracer production in these mice is genetically encoded and does not depend on mechanical tracer injection. Therefore our experimental approach is suitable to study neural circuit formation in the embryonic murine brain. Furthermore, because tracer transfer across synapses depends on synaptic activity, these mouse strains can be used to analyze the communication between genetically defined neuronal populations during brain development at a single cell resolution. Here we provide a detailed protocol for transsynaptic tracing in mouse embryos using the novel recombinant ROSA26 alleles. We have utilized this experimental technique in order to delineate the neural circuitry underlying maturation of the reproductive axis in the developing female mouse brain.
Introduction
해부학 경로 추적은 뇌와 행동 한 관계를 해독하는데 가장 일반적으로 사용되는 도구 중 하나이다. 신경 회로 추적 기술의 발전은 마우스 2 유전자 확인 된 신경 세포 집단에서 신경 회로를 추적 할 수있는 기능 신경 과학자을 수여했다. 이러한 기술적 인 발전에도 불구하고 그것은 특히 배아 성숙 중에 신경 회로의 형성을 해명 도전 남아있다. 현재까지 개발 된 추적 방법 중 대부분 transsynaptic 트레이서 정위 주사 또는 신경성 유전자 변형 바이러스 (도 1) 2,3- 기반으로하기 때문이다. 이러한 기술은 연결 공간 및 시간 해상도, 이러한 현상 뇌, 주사 부위에서 대부분의 impor 주사 부위의 재현성, 잠재적으로 염증 기술적 도전 탐침 주사와 같은 몇몇의 본질적인 한계를 달성하면서신경성 바이러스로 인한 tantly 세포 독성은 4 개 사용을 제한한다.
다른 방법은 유전자 변형 생쥐에서 유전자와 transsynaptic 추적자을 표현하는 것입니다. 우리는 최근에이 기술을 수정 및 유전자 확인 된 신경 세포 인구 5의 신경 회로를 매핑하는 이진 유전 transsynaptic 추적 시스템을 개발했다. Cre 호텔 – 중재 후 우리의 실험 전략은 양방향 추적 보리 렉틴 (BL) 6 ROSA (26) 현장에서 GFP (GTT) (7)에 융합 역행 추적 파상풍 독소 조각 C를 표현하는 두 개의 새로운 녹아웃 마우스 균주를 기반으로 재조합. 여기에서 우리는 선택적으로 kisspeptin을 생산 신경 세포 BL과 GTT, 생식 축 8,9의 성숙을 조절에 관여하는 신경 펩타이드을 표현하는이 마우스 균주를 사용했다. 우리는이 기술 키스의 개발 및 성숙을 시각화하기에 적합 함을 입증여성 마우스의 뇌 (5)의 배아 개발하는 동안 peptin 신경 회로.
번식 전략
R26-BL-IRES-τlacZ (BIZ) 및 R26-GFP-TTC (GTT) 추적 선 노크 재조합 ROSA26 대립 유전자를 전달 계통 5이다. R26-BIZ 및 R26-GTT의 대립으로 인해 두에 loxP 사이트 (5)에 의해 측면 강한 전사 정지 신호의 존재에 전사적으로 침묵. BIZ과 GTT 유전자의 발현은 전사 정지 신호의 Cre 호텔 – 매개 제거에 의해 활성화된다. BIZ-R26 및 R26-GTT 대립 단순히 치운다 드라이버 라인과 교차하여 독립적으로 사용될 수있다. 각각의 Cre 호텔 및 R26 대립 유전자에 대한 분석 동물 이형을 사용할 수있다. 하나 또는 하나 Cre 호텔 R26 대립 유전자를 운반 한배 새끼는 각각 대조군으로 사용되어야한다. 대안 적으로, t를 생성 할 수도있다노크에 riple Cre 호텔, R26-BIZ 및 R26-GTT 대립 유전자를 운반하는 동물, 그러나 이것은 하나의 추가 크로스가 필요합니다.
Protocol
Representative Results
Discussion
유 전적으로 정의 뉴런 집단의 신경 회로를 추적 트랜스 transsynaptic 트레이서로 표현하면 트레이서 neurotopic 바이러스 또는 정위 주사에 비해 몇 가지 장점을 가지고있다. 먼저, 추적기 내인성 단백질로서 생산하고, 따라서 임의의 면역 반응을 유도하지 않으며 선택적 신경 통로 재현성을 다른 동물에서 분석 될 수있다. 이 비 침습적 방법이기 때문에 둘째, 자궁 내, 예를 들어, 정위 주사 쉽?…
Disclosures
The authors have nothing to disclose.
Acknowledgements
We thank Michael Candlish for critical comments on the manuscript. This project was supported by the Deutsche Forschungsgemeinschaft grants BO1743/6 and SFB/TRR 152 P11 and Z02 to Ulrich Boehm.
Materials
| Name of Material/ Equipment | Company | Catalog Number | Comments/Description |
| Bisbenzimide (Hoechst 33258 dye) | Sigma | 14530-100MG | |
| Ethanol | Sigma | 32205-1L | |
| Cryo mold (Peel-a-way) | Polyscience Inc. | 18646A-1 | 22mm x 22mm x 20mm |
| DMSO | Sigma | D8418-100ML | |
| Dimethyl Formamide (DMF) | VWR Chemicals | 23470,293 | |
| EGTA | ROTH | 3054.3 | |
| Fluoromount G | Southern Biotech | 0100-01 | |
| Glutaraldehyde | Sigma | G5882-50ML | |
| Hydrogen peroxide | Sigma | 34988-7 | |
| Isopentane (Methyl 2-butane) | Sigma | M32631-2.5L | |
| Kaiser's Glycine gelatin | Merck | 1092420100 | |
| Methanol | Sigma | 494437-1L | |
| MgCl2 | Sigma | M2670-100G | |
| NaCl | ROTH | HN00.2 | |
| NBT | Sigma | 298-83-9 | |
| Nonidet P40 substitute | Fluka | 743.85 | |
| OCT | Leica | 14020108926 | |
| PAP pen | Dako | S2002 | |
| Parafarmaldehyde | Sigma | P6148-1KG | |
| Sodium deoxycholate | Sigma | D6750-25G | |
| Sucrose | Sigma | S7903-1KG | |
| Superfrost slides | Thermo Scientific | FT4981GLPLUS | |
| TSA kit | PerkinElmer | NEL700 | |
| TSA plus kit | PerkinElmer | NEL749A001KT | |
| Tris | ROTH | AE15.2 | |
| Triton-X 100 | ROTH | 3051.2 | |
| Tween 20 | ROTH | 9127.1 | |
| X-gal | ROTH | 2315.1 | |
| Cryostat | Leica | na | |
| Light microscope equipped with DIC imaging | Zeiss | Axioskop2 equipped with Axio Vision software | |
| Fluroscence microscope | Zeiss | Axioskop2 equipped with Axio Vision software | |
| Photoshop | Adobe | PS6 | |
| Goat anti-WGA (recognizes BL) | Vector Laboatories | AS-2024 | |
| Biotinylayted horse anti-goat IgG | Vector Laboatories | BA-9500 | |
| Biotinylated goat anti-rabbit IgG | Vector Laboatories | BA-1000 | |
| Rabbit anti-GFP (recognizes GTT) | Invitrogen | A11122 | |
| Rabbit anti-GnRH | Affinity Bio Reagent | PA1-121 | |
| Dylight488-donkey anti-rabbit IgG | Thermo Scientific | SA5-10038 | |
| SA-Alexa Fluor 546 | Life Technologies | S-11225 | |
| Primers | |||
| BL Fwd (for BIZ genotyping) | Eurofins MWG Operon | ATGAAGATGATGAGCACCAG GGC |
|
| BL Rev (for BIZ genotyping) | Eurofins MWG Operon | AGCCCTCGCCGCAGAACTC | |
| Cre Fwd (for Cre genotyping) | Eurofins MWG Operon | GTCGATGCAACGAGTGATGAG GTTCG |
|
| Cre Rev (for Cre genotyping) | Eurofins MWG Operon | CCAGGCTAAGTGCCTTCTCTAC ACCTGC |
|
| TTC Fwd (for GTT genotyping) | Eurofins MWG Operon | AGCAAGGGCGAGGAGCTGTT | |
| TTC Rev (for GTT genotyping) | Eurofins MWG Operon | GTCTTGTAGTTGCCGTCGTCCT TGAA |
|
| XY Fwd (for gender genotyping) | Eurofins MWG Operon | TGAAGCTTTTGGCTTTGA | |
| XY Rev (for gender genotyping) | Eurofins MWG Operon | CCGCTGCCAAATTCTTTG | |
| ROSA26 Fwd | Eurofins MWG Operon | CGAAGTCGCTCTGAGTTGTTATC | |
| ROSA26 Rev | Eurofins MWG Operon | GCAGATGGAGCGGGAGAAAT | |
| SA Rev | Eurofins MWG Operon | CGAAGTCGCTCTGAGTTGTTATC | |
References
- Vercelli, A., Repici, M., Garbossa, D., Grimaldi, A. Recent techniques for tracing pathways in the central nervous system of developing and adult mammals. Brain. Res. Bull. 51, 11-28 (2000).
- Huang, Z. J., Zeng, H. Genetic approaches to neural circuits in the mouse. Annu. Rev. Neurosci. 36, 183-215 (2013).
- Lanciego, J. L., Wouterlood, F. G. A half century of experimental neuroanatomical tracing. J. Chem. Neuroanat. 42, 157-183 (2011).
- DeFalco, J., et al. Virus-assisted mapping of neural inputs to a feeding center in the hypothalamus. Science. 291, 2608-2613 (2001).
- Kumar, D., et al. Murine arcuate nucleus kisspeptin neurons communicate with GnRH neurons in utero. J. Neurosci. 34, 3756-3766 (2014).
- Horowitz, L. F., Montmayeur, J. P., Echelard, Y., Buck, L. B. A genetic approach to trace neural circuits. Proc. Natl. Acad. Sci. U.S.A. 96, 3194-3199 (1999).
- Maskos, U., Kissa, K., ST Cloment, C., Brulet, P. Retrograde trans-synaptic transfer of green fluorescent protein allows the genetic mapping of neuronal circuits in transgenic mice. Proc. Natl. Acad. Sci. U.S.A. 99, 10120-10125 (2002).
- De Roux, N., et al. Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54. Proc. Natl. Acad. Sci. U.S.A. 100, 10972-10976 (2003).
- Seminara, S. B., et al. The GPR54 gene as a regulator of puberty. N. Engl. J. Med. 349, 1614-1627 (2003).
- Mayer, C., et al. Timing and completion of puberty in female mice depend on estrogen receptor alpha-signaling in kisspeptin neurons. Proc. Natl. Acad. Sci. U.S.A. 107, 22693-22698 (2010).
- Soriano, P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat. Genet. 21, 70-71 (1999).
- Seibler, J., et al. Single copy shRNA configuration for ubiquitous gene knockdown in mice. Nucleic Acids Res. 33, e67 (2005).
- Semaan, S. J., Kauffman, A. S. Emerging concepts on the epigenetic and transcriptional regulation of the Kiss1 gene. Int. J. Dev. Neurosci. 31, 452-462 (2013).
- Feil, R., et al. Ligand-activated site-specific recombination in mice. Proc. Natl. Acad. Sci. U.S.A. 93, 10887-10890 (1996).
