Embriyonik Fare beyninde İzleme Koşullu Genetik transsinaptik
Summary
Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution.
Abstract
Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits during embryonic maturation of the brain however is technically challenging because most transsynaptic tracing methods developed to date depend on stereotaxic tracer injection. To overcome this problem, we developed a binary genetic strategy for conditional genetic transsynaptic tracing in the mouse brain. Towards this end we generated two complementary knock-in mouse strains to selectively express the bidirectional transsynaptic tracer barley lectin (BL) and the retrograde transsynaptic tracer Tetanus Toxin fragment C from the ROSA26 locus after Cre-mediated recombination. Cell-specific tracer production in these mice is genetically encoded and does not depend on mechanical tracer injection. Therefore our experimental approach is suitable to study neural circuit formation in the embryonic murine brain. Furthermore, because tracer transfer across synapses depends on synaptic activity, these mouse strains can be used to analyze the communication between genetically defined neuronal populations during brain development at a single cell resolution. Here we provide a detailed protocol for transsynaptic tracing in mouse embryos using the novel recombinant ROSA26 alleles. We have utilized this experimental technique in order to delineate the neural circuitry underlying maturation of the reproductive axis in the developing female mouse brain.
Introduction
Anatomik yol izleme beyin ve davranış arasındaki ilişkiyi deşifre 1 en sık kullanılan araçlardan biridir. Nöral devre izleme teknolojileri İlerleme farelerde 2 genetik tanımlanan nöron nüfus nöral devreleri takip yeteneği ile sinirbilimcileri ihsan etmiştir. Bu teknik gelişmelerin rağmen özellikle embriyonik olgunlaşma sırasında nöral devrelerin oluşumunu çözülmeye zor kalır. Bugüne kadar geliştirilen izleme yöntemlerinin çoğu transsinaptik izleyiciler stereotaksik enjeksiyonu ya da genetik olarak tadil edilmiş nörotropik virüsleri (Şekil 1) 2,3 dayalı olmasıdır. Bu teknikler bağlantı mekansal ve zamansal çözünürlük gibi gelişmekte olan beynin, enjeksiyon yerinde ve en impor enjeksiyon yerinde tekrarlanabilirliği, potansiyel inflamasyon içine teknik açıdan zor izleyici enjeksiyonlar gibi çeşitli içsel sınırlamalar elde ederkennörotrop virüslerin neden rı değerlendirilerek sitotoksisite bunların kullanımını sınırlamak 4.
Alternatif bir yöntem, genetik olarak değiştirilmiş farelerde transgenler olarak transsinaptik izleyiciler bildirmektir. Son zamanlarda bu tekniği modifiye ve herhangi bir genetik tespit nöronal nüfusun 5 nöral devreleri eşleştirmek için bir ikili genetik transsinaptik izleme sistemi geliştirdik. Kre-aracılı sonra Bizim deneysel strateji çift yönlü izleyici arpa lektin (BL) da 6 ya da ROSA 26 lokusundan GFP (GTT) 7 kaynaşmış retrograd izleyici Tetanos Toksin parçası Cı sergileyen iki yeni knock-in fare suşlarının dayanmaktadır rekombinasyon. Burada seçici Kisspeptin üreten nöronlarda BL ve GTT, üreme eksen 8,9 olgunlaşmasını düzenleyen karıştığı bir neuropeptide ifade etmek, bu fare suşları kullanıldı. Biz bu teknik öpücük gelişimini ve olgunlaşmasını görselleştirmek için uygun olduğunu göstermekdişi fare beyninin 5 embriyonik gelişimi sırasında peptin sinir devresi.
Yetiştirme stratejisi
R26-BL-IRES-τlacZ (BIZ) ve R26-GFP-TTC (GTT) izleyici hatları knock-rekombinant ROSA26 alleller taşıyan suşlar 5 vardır. R26-dünyası ve R26-GTT aleller bağlı iki loxP sitelerinin 5 tarafından kuşatılır, güçlü transkripsiyon durdurma sinyali, varlığına bağlı olarak, transkripsiyonel olarak sessizdir. Dünyası ve GTT transgenin sentezlenmesi transkripsiyon durdurma sinyali kre-aracılı çıkarılması ile aktive edilir. R26-R26-BIZ ve GTT alleller sadece Cre sürücü hattı ile geçerek bağımsız olarak kullanılabilir. Ilgili Cre ve R26 aleller için analiz hayvanlar heterozigoz için kullanılabilir. Bir Cre ya da bir R26, aleli taşıyan yavrular, sırasıyla, kontrol olarak kullanılır. Seçenek olarak ise, bu t oluşturmak da mümkündürknock-Riple Kre, R26-R26-BIZ ve GTT alleller taşıyan hayvanlar, ancak bu bir ek haçı gerektirir.
Protocol
Representative Results
Discussion
Genetik olarak tanımlanmış sinirsel nöral devreleri iz transgenler olarak transsinaptik izleyiciler ifade ajanları veya neurotopic virüs stereotaksik enjeksiyonu ile karşılaştırıldığında bir çok avantaja sahiptir. İlk olarak, izleyici, bir endojen protein olarak üretilir ve bu nedenle herhangi bir bağışıklık karşılığını ortaya etmez ve seçici bir sinir yolu yüksek ölçüde tekrarlanabilirliği farklı hayvanlarda analiz edilebilir. Bu bir non-invaziv bir yöntemdir, çünkü İkincisi, bu …
Disclosures
The authors have nothing to disclose.
Acknowledgements
We thank Michael Candlish for critical comments on the manuscript. This project was supported by the Deutsche Forschungsgemeinschaft grants BO1743/6 and SFB/TRR 152 P11 and Z02 to Ulrich Boehm.
Materials
| Name of Material/ Equipment | Company | Catalog Number | Comments/Description |
| Bisbenzimide (Hoechst 33258 dye) | Sigma | 14530-100MG | |
| Ethanol | Sigma | 32205-1L | |
| Cryo mold (Peel-a-way) | Polyscience Inc. | 18646A-1 | 22mm x 22mm x 20mm |
| DMSO | Sigma | D8418-100ML | |
| Dimethyl Formamide (DMF) | VWR Chemicals | 23470,293 | |
| EGTA | ROTH | 3054.3 | |
| Fluoromount G | Southern Biotech | 0100-01 | |
| Glutaraldehyde | Sigma | G5882-50ML | |
| Hydrogen peroxide | Sigma | 34988-7 | |
| Isopentane (Methyl 2-butane) | Sigma | M32631-2.5L | |
| Kaiser's Glycine gelatin | Merck | 1092420100 | |
| Methanol | Sigma | 494437-1L | |
| MgCl2 | Sigma | M2670-100G | |
| NaCl | ROTH | HN00.2 | |
| NBT | Sigma | 298-83-9 | |
| Nonidet P40 substitute | Fluka | 743.85 | |
| OCT | Leica | 14020108926 | |
| PAP pen | Dako | S2002 | |
| Parafarmaldehyde | Sigma | P6148-1KG | |
| Sodium deoxycholate | Sigma | D6750-25G | |
| Sucrose | Sigma | S7903-1KG | |
| Superfrost slides | Thermo Scientific | FT4981GLPLUS | |
| TSA kit | PerkinElmer | NEL700 | |
| TSA plus kit | PerkinElmer | NEL749A001KT | |
| Tris | ROTH | AE15.2 | |
| Triton-X 100 | ROTH | 3051.2 | |
| Tween 20 | ROTH | 9127.1 | |
| X-gal | ROTH | 2315.1 | |
| Cryostat | Leica | na | |
| Light microscope equipped with DIC imaging | Zeiss | Axioskop2 equipped with Axio Vision software | |
| Fluroscence microscope | Zeiss | Axioskop2 equipped with Axio Vision software | |
| Photoshop | Adobe | PS6 | |
| Goat anti-WGA (recognizes BL) | Vector Laboatories | AS-2024 | |
| Biotinylayted horse anti-goat IgG | Vector Laboatories | BA-9500 | |
| Biotinylated goat anti-rabbit IgG | Vector Laboatories | BA-1000 | |
| Rabbit anti-GFP (recognizes GTT) | Invitrogen | A11122 | |
| Rabbit anti-GnRH | Affinity Bio Reagent | PA1-121 | |
| Dylight488-donkey anti-rabbit IgG | Thermo Scientific | SA5-10038 | |
| SA-Alexa Fluor 546 | Life Technologies | S-11225 | |
| Primers | |||
| BL Fwd (for BIZ genotyping) | Eurofins MWG Operon | ATGAAGATGATGAGCACCAG GGC |
|
| BL Rev (for BIZ genotyping) | Eurofins MWG Operon | AGCCCTCGCCGCAGAACTC | |
| Cre Fwd (for Cre genotyping) | Eurofins MWG Operon | GTCGATGCAACGAGTGATGAG GTTCG |
|
| Cre Rev (for Cre genotyping) | Eurofins MWG Operon | CCAGGCTAAGTGCCTTCTCTAC ACCTGC |
|
| TTC Fwd (for GTT genotyping) | Eurofins MWG Operon | AGCAAGGGCGAGGAGCTGTT | |
| TTC Rev (for GTT genotyping) | Eurofins MWG Operon | GTCTTGTAGTTGCCGTCGTCCT TGAA |
|
| XY Fwd (for gender genotyping) | Eurofins MWG Operon | TGAAGCTTTTGGCTTTGA | |
| XY Rev (for gender genotyping) | Eurofins MWG Operon | CCGCTGCCAAATTCTTTG | |
| ROSA26 Fwd | Eurofins MWG Operon | CGAAGTCGCTCTGAGTTGTTATC | |
| ROSA26 Rev | Eurofins MWG Operon | GCAGATGGAGCGGGAGAAAT | |
| SA Rev | Eurofins MWG Operon | CGAAGTCGCTCTGAGTTGTTATC | |
References
- Vercelli, A., Repici, M., Garbossa, D., Grimaldi, A. Recent techniques for tracing pathways in the central nervous system of developing and adult mammals. Brain. Res. Bull. 51, 11-28 (2000).
- Huang, Z. J., Zeng, H. Genetic approaches to neural circuits in the mouse. Annu. Rev. Neurosci. 36, 183-215 (2013).
- Lanciego, J. L., Wouterlood, F. G. A half century of experimental neuroanatomical tracing. J. Chem. Neuroanat. 42, 157-183 (2011).
- DeFalco, J., et al. Virus-assisted mapping of neural inputs to a feeding center in the hypothalamus. Science. 291, 2608-2613 (2001).
- Kumar, D., et al. Murine arcuate nucleus kisspeptin neurons communicate with GnRH neurons in utero. J. Neurosci. 34, 3756-3766 (2014).
- Horowitz, L. F., Montmayeur, J. P., Echelard, Y., Buck, L. B. A genetic approach to trace neural circuits. Proc. Natl. Acad. Sci. U.S.A. 96, 3194-3199 (1999).
- Maskos, U., Kissa, K., ST Cloment, C., Brulet, P. Retrograde trans-synaptic transfer of green fluorescent protein allows the genetic mapping of neuronal circuits in transgenic mice. Proc. Natl. Acad. Sci. U.S.A. 99, 10120-10125 (2002).
- De Roux, N., et al. Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54. Proc. Natl. Acad. Sci. U.S.A. 100, 10972-10976 (2003).
- Seminara, S. B., et al. The GPR54 gene as a regulator of puberty. N. Engl. J. Med. 349, 1614-1627 (2003).
- Mayer, C., et al. Timing and completion of puberty in female mice depend on estrogen receptor alpha-signaling in kisspeptin neurons. Proc. Natl. Acad. Sci. U.S.A. 107, 22693-22698 (2010).
- Soriano, P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat. Genet. 21, 70-71 (1999).
- Seibler, J., et al. Single copy shRNA configuration for ubiquitous gene knockdown in mice. Nucleic Acids Res. 33, e67 (2005).
- Semaan, S. J., Kauffman, A. S. Emerging concepts on the epigenetic and transcriptional regulation of the Kiss1 gene. Int. J. Dev. Neurosci. 31, 452-462 (2013).
- Feil, R., et al. Ligand-activated site-specific recombination in mice. Proc. Natl. Acad. Sci. U.S.A. 93, 10887-10890 (1996).
