की प्रजाति विशिष्ट पहचान के लिए लूप की मध्यस्थता इज़ोटेर्माल प्रवर्धन (दीपक) Assays<em> Eimeria</em> मुर्गियों को संक्रमित करते हैं
Summary
Diagnosis of Eimeria infection in chickens remains demanding. Parasite morphology- and host pathology-led approaches are commonly inconclusive, while molecular approaches based on PCR have proven demanding in cost and expertise. The aim of this protocol is to establish loop-mediated isothermal amplification (LAMP) as a straightforward molecular diagnostic for eimerian infection.
Abstract
Eimeria species parasites, protozoa which cause the enteric disease coccidiosis, pose a serious threat to the production and welfare of chickens. In the absence of effective control clinical coccidiosis can be devastating. Resistance to the chemoprophylactics frequently used to control Eimeria is common and sub-clinical infection is widespread, influencing feed conversion ratios and susceptibility to other pathogens such as Clostridium perfringens. Despite the availability of polymerase chain reaction (PCR)-based tools, diagnosis of Eimeria infection still relies almost entirely on traditional approaches such as lesion scoring and oocyst morphology, but neither is straightforward. Limitations of the existing molecular tools include the requirement for specialist equipment and difficulties accessing DNA as template. In response a simple field DNA preparation protocol and a panel of species-specific loop-mediated isothermal amplification (LAMP) assays have been developed for the seven Eimeria recognised to infect the chicken. We now provide a detailed protocol describing the preparation of genomic DNA from intestinal tissue collected post-mortem, followed by setup and readout of the LAMP assays. Eimeria species-specific LAMP can be used to monitor parasite occurrence, assessing the efficacy of a farm’s anticoccidial strategy, and to diagnose sub-clinical infection or clinical disease with particular value when expert surveillance is unavailable.
Introduction
ग्लोबल चिकन उत्पादन विकासशील दुनिया विकसित देशों में देखी लगभग चार गुना विस्तार की मेजबानी के साथ दस गुना से अधिक पिछले 50 वर्षों में वृद्धि हुई है (www.faostat.org) । विश्व खाद्य सुरक्षा के लिए चिकन उत्पादन की प्रासंगिकता हो गया है तो भी मुर्गियों में गंभीर बीमारी का कारण बन सकता है, जो रोगाणुओं की प्रोफ़ाइल है। एक प्रमुख उदाहरण आंतों की बीमारी coccidiosis एक कारण हो सकता है, जो Eimeria प्रजातियों, सर्वव्यापक प्रोटोजोआ परजीवी हैं। मुर्गियां पाला जहाँ भी रहे हैं एक या एक से अधिक Eimeria प्रजातियों 2-4 आम होने की संभावना है। विकसित दुनिया में Eimeria मुख्य रूप से प्रतिरोध 5 के प्रभाव को कम करने के लिए शटल या रोटेशन कार्यक्रमों को रोजगार, रसायनरोगनिरोध द्वारा नियंत्रित कर रहे हैं। लाइव टीके भी पक्षी मूल्य लागत का औचित्य साबित करने के लिए पर्याप्त है, जहां प्रणालियों में इस्तेमाल किया जाता है (उदाहरण के लिए, शेयर, परतों और कुछ broilers के 5 ब्रीडिंग)। एक resu के रूप मेंनैदानिक coccidiosis अक्सर अच्छी तरह से नियंत्रित किया जाता है कि इन उपायों के लेफ्टिनेंट, उप नैदानिक संक्रमण 5 आम है। विकासशील दुनिया टीकाकरण में दुर्लभ है और नशीली दवाओं के आवेदन अक्सर कम अच्छी तरह से सूचित किया। एक परिणाम के रूप में उप नैदानिक और नैदानिक coccidiosis ज्यादा आम है और एक महत्वपूर्ण आर्थिक प्रभाव 3 डाल रही है।
सबसे व्यापक रूप से इस्तेमाल किया स्कोरिंग प्रणाली की भी लेखकों कुछ प्रजातियों के लिए "यह एक ऐसी प्रक्रिया किसी भी लेकिन मामूली गंभीर संक्रमण में प्रयास किया जाना चाहिए कि क्या संदिग्ध लगता है" टिप्पणी की है कि हालांकि eimerian संक्रमण के निदान परंपरागत रूप से, पोस्टमार्टम स्कोरिंग घाव पर भरोसा है 6। आकृति विज्ञान ओवरलैपिंग विशेषज्ञ 6,7 लेकिन सभी उलझाना कर सकते हैं, हालांकि पूरक साक्ष्य, मल या कूड़े के नमूनों में पर्यावरण की दृष्टि से प्रतिरोधी oocyst जीवन चक्र चरण के सूक्ष्म पता लगाने के माध्यम से इकट्ठा किया जा सकता है। पोलीमरेज़ चेन रिएक्शन का उपयोग कर आण्विक विकल्प (पीसीआर), यादृच्छिक amplificatioबहुरूपी डीएनए पीसीआर (आरएपीडी-पीसीआर) और मात्रात्मक पीसीआर प्रौद्योगिकियों के एन 20 साल 8-10 के लिए उपलब्ध किया गया है, लेकिन आज तक वे लोकप्रिय बनने के लिए विफल रहे हैं। सापेक्ष व्यय और विशेषज्ञ प्रयोगशाला के उपकरण या संसाधन के लिए आवश्यकता अक्सर व्यक्तिपरक और तकनीकी रूप से मांग पुराने pathology- की प्रकृति और माइक्रोस्कोपी आधारित 10,11 दृष्टिकोण के बावजूद, उनके तेज सीमित है। ऐसी सीमाओं गरीबी पर coccidiosis का प्रभाव 12 अनुपात में अधिक से अधिक हो सकता है, जहां इस तरह के दक्षिण पूर्व एशिया के रूप में दुनिया के गरीब क्षेत्रों, के कई में अतिरंजित किया जा सकता है। जवाब में, Eimeria प्रजाति विशिष्ट नैदानिक assays के नए सीधा और संवेदनशील है, लेकिन लागत प्रभावी के लिए एक स्पष्ट मांग है।
लूप की मध्यस्थता इज़ोटेर्माल प्रवर्धन (दीपक) डीएनए की एक बड़ी मात्रा amplifying के लिए सक्षम है कि डीएनए पोलीमरेज़ संचालित तकनीक तैयार करने के लिए आसान है। सबसे महत्वपूर्ण बात, दीपक एक Bst डीएनए polymera का उपयोग करता हैएसई के बजाय थर्मल साइकिल 13,14 के लिए आवश्यकता के बिना एक भी लगातार तापमान में डीएनए प्रवर्धन की सुविधा है, जो आमतौर पर पीसीआर में इस्तेमाल Taq डीएनए पोलीमरेज़। दीपक भी सबसे अल्पविकसित प्रयोगशाला में या क्षेत्र में आवेदन करने के लिए उत्तरदायी हो सकता है। कई पीसीआर inhibitors, उच्च संवेदनशीलता और विशिष्टता के सापेक्ष प्रतिरोध द्वारा Characterised, दीपक assays के संक्रमण ब्रुसलरोग रोग वायरस, क्लोस्ट्रीडियम perfringens और क्रिप्टोस्पोरिडियम 15-17 सहित रोगाणुओं की एक विस्तृत श्रृंखला के लिए विकसित किया गया है। जवाब में मुर्गियों को संक्रमित है कि सात Eimeria प्रजातियों में से प्रत्येक के लिए विशिष्ट दीपक assays के एक पैनल के 18 विकसित किया गया है नई लागत प्रभावी Eimeria प्रजाति विशेष के निदान के लिए मांग करने के लिए। नई assays के लिए आवेदन ऐसे गरीब आर्थिक पे के साथ Eimeria Maxima या Eimeria necatrix के रूप में प्रजातियों की एसोसिएशन दिए गए विशेष मूल्य की निगरानी परजीवी घटना में शामिल3,4 rformance। अन्य अनुप्रयोगों के एक खेत की anticoccidial रणनीति, उप नैदानिक संक्रमण या नैदानिक रोग और एक खेत में Eimeria द्वारा उत्पन्न खतरे के मूल्यांकन के निदान की प्रभावकारिता का आकलन करने में शामिल हैं।
Protocol
Representative Results
Discussion
The Eimeria species-specific LAMP assays described in this paper offer a new diagnostic tool kit in support of effective control of coccidia and the disease coccidiosis. The outcomes of eimerian infection can include severe economic loss as well as seriously compromised bird welfare and increased susceptibility to colonisation by zoonotic pathogens21. Opportunities to monitor flocks for the occurrence of some, or all Eimeria species can provide early warning of a breakdown in anticoccidial control efficacy. Key advantages of LAMP include robust target specificity, resulting from the requirement for six different DNA sequence targets, as well as high sensitivity, boosted by the inclusion of loop primers13, although the qualitative, not quantitative nature of LAMP may be considered a limitation. It is not currently possible to discriminate low level parasite escape from routine chemoprophylaxis or live vaccine replication from unchecked eimerian replication. Nonetheless, the technical ease of the protocol and definitive readout offers considerable improvement over the existing specialist and frequently subjective pathology- and morphology-led approaches6,7. Each assay may be completed at a cost of ~£0.75 per sample, independent of labour and equipment set up expenses. Thus, LAMP assays are also more cost effective than other molecular diagnostics such as PCR, since they require an isothermal incubation with no need for specialist equipment.
For many years access to Eimeria genomic DNA as template has limited the development and application of molecular field diagnostics. The oocyst is the most readily accessible phase of the eimerian lifecycle, but routine DNA extraction requires laboratory facilities22. Other, more labile intestinal lifecycle stages require purification prior to DNA preparation to prevent PCR inhibition and a consequent loss of sensitivity23,24. The ability to extract eimerian DNA of a quality suitable for LAMP using equipment no more specialised than a microcentrifuge and a water bath, supplemented by inhibitor adsorption using chelex resin, now promotes the wider use of molecular biology in eimerian diagnostics. Intriguingly, the reported detection of quantitative PCR-measurable Eimeria DNA in intestinal tissue 20 days after the initiation of parasite infection, 11 days after the last detectable oocyst output, raises the suggestion that LAMP may be used to detect resolved parasite exposure as well as ongoing infection, even after any visible lesions may have been resolved25.
The relatively low cost and low technical requirements of LAMP Eimeria diagnostics can promote their application in the developing world where other more established approaches may not be available or appropriate. For this to be applicable each assay must be capable of detecting all strains which may be circulating within each region. While understanding of the genetic diversity prevailing among Eimeria species is limited26, the use of target sequences previously validated for use in quantitative PCR with strains from Africa, Asia, Europe and South America provides some evidence of conservation, supporting the utility of these LAMP assays around the world10.
Disclosures
The authors have nothing to disclose.
Acknowledgements
The work carried out in this study was supported in part by the Royal Veterinary College through the student research projects fund, as well as the Biotechnology and Biological Sciences Research Council and the Department for International Development (grant number BB/H009337/2). This manuscript has been assigned the reference PPB_00795 by the RVC.
Materials
| Name | Company | Catalogue number | Comments |
| RNAlater | Ambion | AM7024 | |
| Ethanol | VWR Chemicals | 20821.321 | Caution, highly flammable |
| 100 x Tris-EDTA (TE) buffer concentrate | Sigma-Aldrich | T9285 | |
| Chelex 100 resin | Bio-Rad | 142-1253 | |
| Molecular grade water | Invitrogen | 10977035 | |
| E. acervulina F3 | Sigma-Aldrich | VC00021 | *CCTAACATTTCGCTTCACGGAC |
| E. acervulina B3 | Sigma-Aldrich | VC00021 | *ATGAGCAAGTGGAACACCTTG |
| E. acervulina FIP | Sigma-Aldrich | VC00021 | *AGAGCACAGTGGCAGTGC-AGCAGACAGCATGGCTTACCT |
| E. acervulina BIP | Sigma-Aldrich | VC00021 | *GAAGACCCTCTGAAGAACGGA-CCTTCTCACCGCTTACCGG |
| E. acervulina LB | Sigma-Aldrich | VC00021 | *TAAGGTTACACCCGTGGAGG |
| E. acervulina LF | Sigma-Aldrich | VC00021 | *GCCATGCACAAAGCGACTT |
| E. brunetti F3 | Sigma-Aldrich | VC00021 | *GGCCATCAAGTTCCATGAGC |
| E. brunetti B3 | Sigma-Aldrich | VC00021 | *TCAACCTCCTGAGTGTGGTT |
| E. brunetti FIP | Sigma-Aldrich | VC00021 | *GAAAATGCCTTCGTAGCTGCT-GCTGGGTACGGAGCGTCTT |
| E. brunetti BIP | Sigma-Aldrich | VC00021 | *TACTTCCTAGGATCCATCCTCGC-AGTTTCGCTGCCGCCTC |
| E. brunetti LB | Sigma-Aldrich | VC00021 | *GAAACGCTCGAACATGGC |
| E. brunetti LF | Sigma-Aldrich | VC00021 | *CTTCTCCACAGACCCAGAGGT |
| E. maxima F3 | Sigma-Aldrich | VC00021 | *ACTACGGAAAAGTGCGTAGCT |
| E. maxima B3 | Sigma-Aldrich | VC00021 | *CCTTCCTCCCTTCTGAAAACTG |
| E. maxima FIP | Sigma-Aldrich | VC00021 | *GAGTCACTGCTGATGTACCAAA AG-GAACTATGCCGCTTTCCCCTG |
| E. maxima BIP | Sigma-Aldrich | VC00021 | *AGAATGCGGATTTGTTAGCAGC-AGCAAGTCCAAGGTGTGTGTA |
| E. maxima LB | Sigma-Aldrich | VC00021 | *CAAGCCTACGCGGACATC |
| E. maxima LF | Sigma-Aldrich | VC00021 | *TTATGCAGCTGGGTCAACG |
| E. mitis F3 | Sigma-Aldrich | VC00021 | *ACGATAGCCAAGACACGTAAGG |
| E. mitis B3 | Sigma-Aldrich | VC00021 | *CCCCGTGATAAGAGTAGGAACA |
| E. mitis FIP | Sigma-Aldrich | VC00021 | *CGCGGGTCGTGAGATTTAAATT AT-GGAAGATCAGGACGGGCACT |
| E. mitis BIP | Sigma-Aldrich | VC00021 | *GTTTCAGTTGATGAACAAGCGA GA-TGCGCCTCTAGAATCAAGACG |
| E. mitis LB | Sigma-Aldrich | VC00021 | *TCCATGCATCCCCTTGTT |
| E. mitis LF | Sigma-Aldrich | VC00021 | *CGTGGGCACAGATTGATTC |
| E. necatrix F3 | Sigma-Aldrich | VC00021 | *TGGCTTTCCCGCGTACC |
| E. necatrix B3 | Sigma-Aldrich | VC00021 | *CGGCCCAACACAAAGACTG |
| E. necatrix FIP | Sigma-Aldrich | VC00021 | *CGCTTGAGTTTTAAGCTATGCA CA-GACCCAAGCAGCTCACCAA |
| E. necatrix BIP | Sigma-Aldrich | VC00021 | *CGCCATGCCATTCAATGAACG-*GAGGCATACCGGCGTTGTC |
| E. necatrix LB | Sigma-Aldrich | VC00021 | *GTCTGTAACTTGGGACGTTGT |
| E. necatrix LF | Sigma-Aldrich | VC00021 | *GAACAGCCGGAGCCTCTC |
| E. praecox F3 | Sigma-Aldrich | VC00021 | *GCCCTTGTATGTTGCTGTTTCT |
| E. praecox B3 | Sigma-Aldrich | VC00021 | *GCGCACGAATCTGAATCACAC |
| E. praecox FIP | Sigma-Aldrich | VC00021 | *ATCTCCTCAAAGACTTTCGCGT A-GCGCTTGGCTATATCCATAGG |
| E. praecox BIP | Sigma-Aldrich | VC00021 | *GCTCTCGTGGCATACTTGC-GCCAGGAGCCACTGATTGT |
| E. praecox LB | Sigma-Aldrich | VC00021 | *GAATAGCATTGCCAGGTGG |
| E. praecox LF | Sigma-Aldrich | VC00021 | *GTCCACTGTCATTAATATTGC TGC |
| E. tenella F3 | Sigma-Aldrich | VC00021 | *GCTTGTGAAGGTCAGCGTG |
| E. tenella B3 | Sigma-Aldrich | VC00021 | *GCTGAGTCCATACGTACTTCCT |
| E. tenella FIP | Sigma-Aldrich | VC00021 | *GCCACTGCTATGGAAAGTCAC AC-CATAACTGGCATGCAGGGGT |
| E. tenella BIP | Sigma-Aldrich | VC00021 | *GTTTGGCCCGAAAGTTGTGAA GA-CGTCAGAAATTGCTGCCCAAT |
| E. tenella LB | Sigma-Aldrich | VC00021 | *CGCATGTGCAGTTGAAGACA |
| E. tenella LF | Sigma-Aldrich | VC00021 | *CCAAATGTATCTGCTAGTTATA TTAACAAG |
| 10 x ThermoPol reaction buffer | New England Biolabs | B9004S | |
| MgSO4 | Sigma-Aldrich | M7506 | |
| dNTPs | Promega | U1330 | |
| Betaine solution (5 M) | Sigma-Aldrich | B0300 | |
| Bst polymerase | New England Biolabs | M0275S | |
| Hydroxynaphthol blue | Sigma-Aldrich | 33936 | Dissolved in molecular grade water. |
| UltraPure agarose | Invitrogen | 16500-500 | |
| 10 x Tris/Borate/EDTA (TBE) buffer | Invitrogen | AM9863 | |
| Blue/Orange DNA loading dye (x6) | Promega | G1881 | |
| GeneRuler 1Kb DNA ladder | Thermo Scientific | SM0313 | |
| SafeView nucleic acid stain | NBS Biologicals | NBS-SV |
References
- Chapman, H. D., et al. A selective review of advances in coccidiosis research. Adv Parasitol. 83, 93-171 (2013).
- Shirley, M. W., Smith, A. L., Tomley, F. M. The biology of avian Eimeria with an emphasis on their control by vaccination. Adv Parasitol. 60, 285-330 (2005).
- Fornace, K. M., et al. Occurrence of Eimeria species parasites on small-scale commercial chicken farms in Africa and indication of economic profitability. PLoS ONE. 8 (12), e84254 (2013).
- Schwarz, R. S., Jenkins, M. C., Klopp, S., Miska, K. B. Genomic analysis of Eimeria spp. populations in relation to performance levels of broiler chicken farms in Arkansas and North Carolina. J Parasitol. 95 (4), 871-880 (2009).
- Peek, H. W., Landman, W. J. Coccidiosis in poultry: anticoccidial products, vaccines and other prevention strategies. Vet Q. 31 (3), 143-161 (2011).
- Johnson, J., Reid, W. M. Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp Parasitol. 28 (1), 30-36 (1970).
- Haug, A., Gjevre, A. G., Skjerve, E., Kaldhusdal, M. A survey of the economic impact of subclinical Eimeria infections in broiler chickens in Norway. Avian Pathol. 37 (3), 333-341 (2008).
- Procunier, J., Fernando, M., Barta, J. Species and strain differentiation of Eimeria spp. of the domestic fowl using DNA polymorphisms amplified by arbitrary primers. Parasitology Research. 79 (2), 98-102 (1993).
- Schnitzler, B. E., Thebo, P. L., Mattsson, J. G., Tomley, F. M., Shirley, M. W. Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic Eimeria species of the chicken. Avian Pathol. 27 (5), 490-497 (1998).
- Vrba, V., Blake, D. P., Poplstein, M. Quantitative real-time PCR assays for detection and quantification of all seven Eimeria species that infect the chicken. Vet Parasitol. 174 (3-4), 183-190 (2010).
- Morris, G. M., Gasser, R. B. Biotechnological advances in the diagnosis of avian coccidiosis and the analysis of genetic variation in Eimeria. Biotechnol Adv. 24 (6), 590-603 (2006).
- Perry, B., Randolph, T., McDermott, J., Sones, K., Thornton, P. . Investing in animal health research to alleviate poverty. , (2002).
- Nagamine, K., Hase, T., Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers). Mol Cell Probes. 16 (3), 223-229 (2002).
- Notomi, T., et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28 (12), E63 (2000).
- Kaneko, I., et al. Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods. Appl Environ Microbiol. 77 (21), 7526-7532 (2011).
- Karanis, P., et al. Development and preliminary evaluation of a loop-mediated isothermal amplification procedure for sensitive detection of cryptosporidium oocysts in fecal and water samples. Appl Environ Microbiol. 73 (17), 5660-5662 (2007).
- Xue, C., et al. Rapid detection of Infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification assay. J Vet Diagn Invest. 21 (6), 841-843 (2009).
- Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. BMC Vet Res. 7 (1), 67 (2011).
- Long, P., Joyner, L., Millard, B., Norton, C. A guide to laboratory techniques used in the study and diagnosis of avian coccidiosis. Folia Veterinaria Latina. 6 (3), 201-217 (1976).
- Goto, M., Honda, E., Ogura, A., Nomoto, A., Hanaki, K. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. BioTechniques. 46 (3), 167-172 (2009).
- Arakawa, A., Baba, E., Fukata, T. Eimeria tenella infection enhances Salmonella typhimurium infection in chickens. Poult Sci. 60 (10), 2203-2209 (1981).
- Blake, D. P., Smith, A. L., Shirley, M. W. Amplified fragment length polymorphism analyses of Eimeria spp.: an improved process for genetic studies of recombinant parasites. Parasitol Res. 90 (6), 473-475 (2003).
- Lund, M., Nordentoft, S., Pedersen, K., Madsen, M. Detection of Campylobacter spp. in chicken fecal samples by real-time PCR. J Clin Microbiol. 42 (11), 5125-5132 (2004).
- Raj, G. D., et al. Real-time PCR-based quantification of Eimeria genomes: a method to outweigh underestimation of genome numbers due to PCR inhibition. Avian Pathol. 42 (4), 304-308 (2013).
- Blake, D. P., Hesketh, P., Archer, A., Shirley, M. W., Smith, A. L. Eimeria maxima: the influence of host genotype on parasite reproduction as revealed by quantitative real-time PCR. Int J Parasitol. 36 (1), 97-105 (2006).
- Beck, H. P., et al. Molecular approaches to diversity of populations of apicomplexan parasites. Int J Parasitol. 39 (2), 175-189 (2009).
